Russell's Blog

New. Improved. Stays crunchy in milk.

Uzon, Day One

Posted by Russell on August 15, 2010 at 5:01 p.m.
The day began with a breakfast of rehydrated oatmeal, instant coffee (my espresso had not yet been located amongst the luggage), and yogurt. Just as we were drifting off to unpack and organize, a juvenile bear showed up on our doorstep, and snuffled around a bit near our outhouse and the little bridge over the stream.


A bear visiting the research station on our first day in Uzon. That boardwalk is the path to our outhouse; this was shot with a short lens from the kitchen porch.

This is why we carry signal flares to the toilet, and only go in groups.

After watching the bear wander off to forage for blueberries (which are everywhere), I sat down on the little bridge and made myself a cup of espresso from the stream water. The Russian team upstairs tells me that when they've tested it, it came back almost as clean as the molecular-grade water they brought with them. It was the best damn espresso I've ever had.


Espresso.

Preparations for sampling and measurements proceeded in fits and starts through the morning as Albert, Frank and Anna hammered out a plan for each day of the expedition. While that was going on, Bo, Sarah and I continued unpacking and organizing the gear.

I attempted to shave at the stream, but this did not go as well as the espresso. Hot water is important for shaving, and I didn't make enough of it. The stream is only seven degrees Celsius, which I discovered is utterly unsuitable for shaving.


Shaving did not go so well.

Around ten o'clock, the ranger took us on a tour of the thermal fields. Frank and Albert have been here several times of course, but the fields are never quite the same year-to-year. In 2008, for example, a geyser popped up near the ranger station; Uzon is not known to have geysers.


Zavarzin, one of my metagenomic targets. Alex is measuring the temperature, and we worked around some enrichment cultures set up by another research team.

We stopped by Zavarzin Spring along the way, which was particularly interesting for me. For the last few months, I've been analyzing some metagenomic data taken from Zavarzin a few years ago as part of the Tree of Life project. Until today, Zavarzin was just a FASTA file containing about ten thousand Sanger reads, like so :

>ZAVAK94TR 6000 12000 9000 21 953 GTAGCTGTAAGGGCGGGGAGGGCTCACCTGGTCCCGGCCTTCGACGGCGGCCCCAATCCG GCCAGCGCCCAGGCCCTCACCGAAGTCGAAGCCTACGCCTTTTCCTGTTCCGATTTCCGG AAACTGATAGGGGAGTTCCCCCGGATTGCCGGCAATATCCTGGCCGATTTTGCCGCCAAA TTGCGCCTGCTGGTAGGGCTGGTGGAGGACCTCTCCTTCCGTACGGTGGAGGCGCGTCTG GCCCGTTTCCTCCTGAGCCGGGATGTGGCCGTGCCCGGCCGGCGCTGGACCCAGGAGGAG ATGGCCGCCCACCTGGGCACGGTGCGCGAGGTGGTCGGCCGAGTGCTTCGGGCCTGGCGT GAGGAGGGTCTGATTCGCCAGGAACGCGGCCGCATCGTCATCCTGGACCGGGCCGCGCTG GAGAAGAAGGCTCAAATCTGACATCATTCGTGCCAGGACGAGTTATGCAAAGATGTCAGG AAAAAGGACTTTTTGACAAAGAGAGGGGAATATGCTACATTGTCAGCCCCGGAGGGCCGG CCCGCATGGACCAACCGCATCCGGGTGACCCGAAAGGCAGAAACGTTCGGGCAGGCTGAT GATGGACACGTTCCGCGCCATCCGTCGGGTCCTCTGGATCACGATGGGGCTCAACCTTCT GGCTATGGCGGCCAAACTGGGCGTGGGCTACCTCACCGGCTCCCTCAGCCTGGTCGCCGA CGGCTTCGATTCGGCCTTTGACGGTGCCTCCAACGTGGTGGGGCTGGTGGGGATTTATCT GGCCGCCCGACCGGCCGACGAAGGCCACCCCTACGGCCACCGCAAGGCCGAAACCCTCAC CGCCCTGGGCGTCTCCGCCCTCCTCTTCCTGACGACCTGGGAACTGGTGAAGAGCGCGGT CGAGCGCCTGCGCGACCCGACTCGGATACAGGCCGAGGTCACGGTCTGGAGTTTCGGGGC CCTCGTCCTCAGCATCCTGGTGCACGCGACCGTGGTCTGGTACGAGATGCGGGAGGGCCG GCGGTTGAGGAGCGATTTCCTGGTGGCCGATGCCCAGCACAC
After so much time working on this data, it was pretty exciting to see the actual site.

I came back to the research station with Albert and Bo, and I fixed some lunch for everyone (apples and pears with Nutella, cheese and black bread, olives, some cucumbers sliced with lemon and dill, and the ubiquitous Russian sausage for the meat eaters).

After lunch, everyone except Bo went back to Zavarzin (Bo stayed at the station to work on the electrodes for his instrument). Albert and Sarah took measurements and tried out some home-made core samplers, and Anna and Alex started some enrichment cultures. This was a preliminary trip, so I mostly just tried to stay out of the way. I got some nice photographs of the rather extraordinary microbial mats growing in the smaller springs nearby.

I mentioned in a previous post that volcanic liquids are very diverse; this is the reason it's worth traveling all the way to Kamchatka. Here is a nice example of what I was talking about. These are three springs within about four feet of each other. You can see just by looking at them that they are different. The colors range from in clear to white to gray, indicating different redox states (probably of sulfur); the temperature ranges from 91C, to 86C to 81C, and the pH from 7 to 5.6 to 6.1.


Three adjacent yet very different springs.

That might not sound particularly dramatic, but recall that when you catch a fever, the shift from 37 degrees to 39 degrees is enough to halt the growth of a wide array of organisms. This is why fever is a response to infection. Microbes often adapt to very particular circumstances, and so a change of a few degrees can shift the ecology dramatically, or replace it altogether. As environments, these three springs are as different from each other as the inside of your mouth and the eyelid of a duck.

We finished up with our poking around at Zavarzin, and came home for a dinner of Borscht prepared by Anna. It was delicious. After dinner, we started setting up our lab space upstairs for DNA extractions. I managed to trip the breaker on the generator several times trying to charge up the UPSs.

Ignore this field:
 optional; will not be displayed
Don't put anything in this field:
 optional
Don't put anything here:
Leave this empty:
URLs auto-link and some tags are allowed: <a><b><i><p>.