My talk at the Thermophiles Workshop
So, I submitted an abstract titled, "Classification of environmental sequence data using multiple sources of inference." This project is a collaboration with Andrey Kislyuk, who has just graduated from Georgia Tech, supervised by Joshua Weitz. It's a pretty cool project, but Andrey has just graduated and moved on to Pacific Biosciences, so things haven't moved as quickly as I would have liked.
After the first day of talks, I started to get pretty nervous; I thought I would have some downtime during the field expedition to work on my slides. Downtime when Frank Robb, Albert Colman and Anna Perevalova are around? Ha! If I'd met them before walking off the airplane in Petropavlovsk, I would have known how ridiculous an idea that was.
To make matters worse, the organizers had to shift the schedule forward by a day because weather delayed the excursion to Uzon (which I was not planning to join, since I'd just spent a week there). Thus, I found myself in the position of giving and unfinished talk about an unfinished project. Worse, I was going to stand up and talk about probability theory and Bayesian priors to a roomfull of people who ride submarines into underwater volcanoes and discover whole new branches of Earthly life. Worse still, I had to follow Frank Robb's talk about isolating and sequencing organisms that grow on syngas, which he had to cut short because there was just too much awesome for one talk to hold.
To my surprise, I manged to finish the slides during lunch and the coffee break. Also to my surprise, I got a lot of really great questions, and lots of people seemed weirdly excited about the idea of using more than one mathematical technique for sifting through metagenomic data.
I've recently started working on one such analysis (a different project altogether), and I'm gaining an appreciation for just how difficult it is. Perhaps the interest in my talk has more to do with the fact that people in the field really, really want better tools, and there's a lot of enthusiasm for anything that looks halfway promising.
Also, I have to give a big thumbs up to the Russians (and other folks) who gave their talks in English. I once had to give a brief talk on physics in Japanese, and it was one of the most difficult, stressful experiences of my life. It was only five minutes, and I was aided by the fact that Japanese borrows many technical and scientific terms from English. It's not really fair that English is the de facto international language, but I'm really, really glad it is.
Thermophiles workshop overview
Back at the apartment in Petropavlovsk, we tried (and mostly failed) to get the smell of hydrogen sulphide off of us.
Then next day, we piled into another taxi-van and rode to the Flamingo Hotel, where the workshop will start tomorrow.
Update : Below is a summary of my favorite talks at the workshop that I wrote on the flight back to California.
There have been a number of really exciting talks here at the workshop, and I can't summarize all of them. So, here are a few talks that have kept me thinking.
Sergey Varfolomeev : The youngest natural oil on Earth
Carbon-14 dating indicates that Uzon contains petroleum-like oil that is less than 50 years old. Very similar compounds were obtained by low-temperature pyrolysis of cyanobacteria and microalgae isolated in the vicinity to the hydrocarbon sample sites.
Albert Colman : Chemistry and geobiology of life in hot carbon monoxide
One of the key events in the establishment of our existing ecology was the development of an oxygen rich atmosphere. This process occurred in several stages, and one of the key stages marked the end of the Archean eon. Archean ecosystems are thought to have included oxygen-producing organisms, but during the Archean eon there were enough free reducing compounds in the atmosphere, ocean and soil to consume all the oxygen they produced. The Archean eon ended when these chemical oxygen sinks were finally overwhelmed, and oxygen started to build up in the atmosphere. In order to understand how and why we have an oxygen-rich atmosphere, it is important to understand how the Earth's atmosphere worked during this period.Albert and his group are studying the role of carbon monoxide in the Archean atmosphere. There are a variety of organisms that exist today (particularly in volcanic environments like Uzon) that grow on carbon monoxide, and for this reason, the biosphere is usually treated as a sink for carbon monoxide. However, there are also organisms that produce carbon monoxide as a waste product, and so the coupling of atmospheric carbon monoxide to the biosphere in Archean climate models needs to treat the biosphere as a source and a sink to properly capture the dynamics.
I find all of this to be fascinating. It's very important that we get a handle on this stuff; mankind has been conducing a huge, uncontrolled experiment with the Earth's atmosphere since around 1820. Learning about other such "experiments" in Earth's history (in Archean, by microbes rather than humans) is pretty important.
Evengy Nikolaev : Mass spectrometry
I had no idea there were so many kinds of mass spectrometers! I guess that's what I get for my background in theoretical physics. My inclination is to write
and call it a day. Mass spectrometry, to me at least, has always meant this :
Schematic of a basic mass spectrometer.
If you stick some ions in a constant magnetic field, their orbital frequencies will depend only on their mass and charge. So, you just aim your beam of ions through a magnet, and all your ions will segregate out like colors in a rainbow. Done. High school physics, right? Wrong!
Evengy's talk was like looking up a recipe for pancakes and discovering that there are breakfast, lunch, tea, and dinner pancakes; that they can be made from fifty different grains and pulses; and that there are pancake recipes suitable for every occasion ranging from a quick bite while driving to work in the morning to the main course of a king's coronation. That's a lot of mass spectrometry!
Juergen Wiegel : Interspecies heterogeneity and biogeography of Thermoanaerobacter uzonensis
I'm really interested in biogeography generally, and so I was waiting for this talk. The Baas-Becking hypothesis that "everything is everywhere, but the environment selects" has been one of the key ideas in microbiology. As gene sequencing has gotten more powerful, it has been possible to test this hypothesis with increasing confidence. Juergen presented some findings that take another step toward disproving hypothesis and establishing the importance of locality in evolution.Basically, his group at the University of Georgia obtained 16s small subunit rRNA sequences from Thermoanaerobacter uzonensis isolates collected in different spots in Kamchatka. The collection sites ranged from a few meters apart to about 300 kilometers. It was found that divergence among the sequences correlated positively with geographic distance.
The environment does indeed select, but the Baas-Becking hypothesis only holds for fuzzy definitions of "everything" and "everywhere."
Anna Perevalova : Novel thermophilic archaea of order Fervidicoccales - diversity, distribution and metabolism
I had been bugging Anna during the field expedition to tell me more about Fervidococcus fontis, which she discovered. F. fontis grows between 55C and 85C, which is an unusually wide range. The genome has recently been sequenced, and she presented some of the preliminary results from the annotation.I still find it mysterious how one sets out to find new species (in this case, a new genus). Anna works in Elizaveta Bonch-Osmolovskaya's lab at the Winogradsky Institute of Microbiology, where they used a technique I'd never heard of called Denaturing Gradient Gel Electrophoresis and a myriad of selective media cultures to coax this organism out of the woodwork. Pretty hard-core, if you ask me.
Sergey Gavrilov : Electrochemical potential and microbial community composition of bioelectrochemical systems employed in situ in hotsprings of Uzon Caldera
This is a pretty awesome idea. Microbial fuel cells exploit the fact that cellular metabolism requires the transport of electrons outside the cell to deposit on acceptor substances, and couple this process to an electrical circuit. Sergey discussed a modification of this idea called sediment microbial fuel cell; instead of growing his microbes in the lab, he carried his cathode and anode out into the field and stuck them into a sedimentary formation in the environment.The awesome part of this study is that Sergey isn't just looking for high power output. He's using the fuel cell to select for current-producing organisms from a diverse community, and then studying those organisms. After letting his circuits run for ten days, he found biofilms growing on the electrodes that had very different community structure from the controls (same setup, but with an open circuit). It's basically an enrichment culture that enriches for microbes that like to make electricity.
David Bernick : New discoveries in the hyperthermophilic genus Pyrobaculum enabled by deep RNA and genome sequencing
It's interesting to see how much fine structure can be found when an organism is sequenced deeply enough to capture it. David's team is using massive Illumina sequencing to do something like the Hubble Deep Field for an archaeal genome and its small RNA. They also sequenced a new member of the genus, P. oguniense, and discovered therein a new virus and a number of cool virus-related genomic features in the host.
Frank Robb : Lessons learned from sequencing carboxydotrophic bacteria and the race to discover hyperthermophilic cellulases
Frank was the only person at the workshop to give two talks, and they were both pretty cool. The first talk summarized results presented in a paper amusingly titled ‘That which does not kill us only makes us stronger’: the role of carbon monoxide in thermophilic microbial consortia. This work covered a lot of ground, including some compelling evidence for archaea-to-bacteria lateral gene transfer of chaparonins, as well as a results showing rapid accumulation of frameshift mutations when C. hydrogenoformans is grown under syngas, allowing it to grow rapidly by fixing carbon monoxide from syngas. Syngas is also known as wood gas, a simple intermediate for converting a variety of biomass feedstocks into usable fuel. If one wanted to obtain pure hydrogen gas from syngas, an organism that can eat the carbon monoxide could be handy.The second talk presented some really interesting work in which a consortium of one cultured and two novel archaea was isolated from a thermal spring in Nevada that was able to grow on filter paper at 90C. A cellulase capable of degrading crystalline cellulose into reducing sugars at 100C was isolated, and the genes responsible were cloned and expressed in E. coli.
This is also pretty exciting for the biofuels people. One of the problems with moderate-temperature cellulases is that it's impossible to keep a huge vat of wet, ground up plants sterile. As soon as cellulase activity starts putting simple sugars into solution, something will start to eat the sugars. However, if you conduct the process at pasteurization temperatures, then you just have to worry about contamination by hyperthermophiles. So, as long as you keep people like Frank Robb and Karl Stetter from dropping their used lab equipment into your processing vat, you should get a nice yield of sugars from the cellulose without having it all eaten up by pesky yeasts and suchlike.
Uzon, Day Seven
Sarah and Albert managed to finish the DNA extractions last night, much to everyone's relief. Early that morning, we were visited by another bear, which we caught on video this time.
As we started packing up our gear, we got word that the helicopter would be arriving to pick us up around mid-morning, rather than mid afternoon as we had expected. A furious scramble to pack everything up began, and Frank set off into the field alone to retrieve enrichment cultures that we hadn't collected yesterday.
I tried my best to stay out of the way, since I had already mostly packed up the day before (no great accomplishment -- I didn't bring much in the first place). All of my samples were already safely stowed with Albert's. In retrospect, I should have gone with Frank to help him, but he vanished almost the instant we heard the thwak-thwak of the helicopter coming over the caldera wall.
Bo He carrying equipment to the helicopter flight from Uzon.
Just as we finished packing the helicopter, Frank came charging over the ridge from Central Thermal Field carrying all the enrichment samples he could find.
Packing the helicopter.
Amazingly, we only left a few things behind. A small digital camera, my toothbrush, and a few enrichment samples that sank too deep into one of the springs. Later on, Albert was able to retrieve the samples and the camera by joining the workshop excursion. He did not retrieve my toothbrush.
Karymsky volcano erupted again on our flight back. A most majestic farewell.
On our flight back, Karymsky volcano erupted again, again just as we flew past. It was a majestic farewell indeed.
I really, really regretted having to leave Uzon. It was a privilege and an honor to have gone, and to have gone with such company. In the next weeks and months I will have to work very hard; perhaps a big enough scientific payoff might justify a return trip. I certainly hope so!
Uzon, Day Six
Russia is working hard to reign in the chaos that followed the end of the Soviet Union, and Kronotsky National Biosphere Park is no exception. Restrictions on hunting and fishing that were once widely ignored or impossible to implement are now being enforced. The rules are not exactly settled, but it is clear that the park administration is serious about protecting the wild state of the preserve. This is a Very Good Thing.
In 2005, Frank joined an expedition to Uzon led by Juergen Wiegel; this was before the research station was built, and so they flew in several large tents packed in crates. The crates could be unfolded to form a platform for the tents. When they broke camp, they left the crates behind. If the park administration is going to be serious about protecting the natural state of the caldera, Frank and Albert thought it would be a good idea to do our part too. So, we spent the morning breaking down the crates at the 2004 camp. We then hauled the disassembled crates to the research station (new since 2004), and arranged them in neat stacks. The rangers will find some use for the wood now that in easy reach, I'm sure.
When we arrived, the crates from the old camp were piled up in the middle of the camp. I'm not sure exactly how long the crates were splayed over the ground at the old site (they were designed to form a platform for the tents) before they were piled up there, but I find it interesting that the footprint of the old camp is still clearly visible. The plants are still in the process of recolonizing the space. There can be no more explicit evidence that Uzon's ecology is indeed fragile. The lush meadows I wrote about yesterday would probably take decades or centuries to form if they had to start over from scratch. I'm sorry I don't have any pictures; one cannot be both a good photographer and diligent manual labor at the same time.
Alex thinks he has pulled a fast one on me. Anna is not amused by any of this. Not even Frank's hat.
After lunch, Frank and I set out together to collect some samples from Burlyaschy and K4 Well.
Collecting a sample from Burlyaschy (Boiling Spring). It's about 90C where my feet are, and it's deeper than my ankles. It's a good thing I'm wearing thigh waders and three pairs of socks!
While Frank was working on his own samples, I waded a few meters into Burlyaschy Spring to fill a liter bottle with water. The water is about 90C there, and boiling vigorously only three or four meters beyond. I was wearing three layers of insulated gloves, and three pairs of socks under my waders, but the heat was almost unbearable. You really don't want to fall down in this thing!
Filtering a liter of water from Burlyaschy with a Sterivex filter and a 60ml syringe. The bottle was almost too hot to handle, even with insulated gloves. If there's anything alive in the planktonic community, it's definitely a hyperthermophile!
After (carefully) returning to what passes for dry land in the thermal field, I decanted the liter bottle into a 60ml syringe with a LuerLok fitting, and attached a Sterivex-HV 0.45 micron filter. I then forced the water through the filter, which started to block up after about 600ml. The last 300ml went through really, really slowly and with a lot of sweat and cursing. It took a 20 repetitions to finish off the bottle.
Decanting spring water collected from K4 Well into a 60ml syringe, to be forced through a Sterivex filter.
After that, we walked over to K4 Well to collect Frank's slides. Frank is planning to use them for electron microscopy, so he had to fix them before storing them, which took a long time. This gave me time to process two liters of water and steam spewing from the rupture on the K4 wellhead and shove them through two more Sterivex filters.
We walked back to the station, and I fixed my filters in ethanol and D-PBS buffer.
This was to be our last full day in Uzon, so I packed most of my things before going to bed. Albert and Sarah stayed up all night finishing the DNA extractions.
Uzon, Day Five
The weather is absolutely beautiful today; sunny with a few puffy, fast-moving clouds, about 60F with gusts of cool wind.
After breakfast, Frank, Alex, Anna and I hiked to Orange Field. Most of the hike was over open country without trails; we had the GPS coordinates, but no route. We passed through a few stands of birch and pine. The prospect of encountering a bear in enclosed areas makes entering these clumps of trees an unattractive course of action, one could say. Encountering the occasional bear seems to be unavoidable in Uzon, so we stuck to open country and burned up some calories circling around the trees. The August sun could have made this torture back in Davis, but at almost 55 degrees north with patches of snow lurking in the shady spots of the caldera, it wasn't so bad.
A meadow abutting the caldera wall on the hike to Orange Field springs.
It's astonishing how much plant diversity there is here. What looks like fields from a distance are really dense mixtures of dozens (hundreds?) of species of plant, crowded together in a tangled riot. When I put my face near the ground, it looks a tropical rain forest, only ten inches high.
We are here to study microbes, but it's very difficult not to wonder about this hardy community of plants. How do they survive the winter? Why does one kind of plant cluster in one place and not another? For what do they compete, and how do they do it? Do any of them cooperate? How do the seeds disperse? What pollinates the flowers?
I am puzzled I that there seem to be so few pollinators in Uzon. I found a few insects that looked like bees, but I'm not familiar enough with entomology to rule out the possibility that they could be bee-like flies, or possibly wasps. In any event, there were not very many of them. The only insect I found visiting a flower today is a thing that looked like an earwig, but it was probably there because it took a wrong turn somewhere. The millions of flowers in Uzon seem to go mostly unvisited.
Panorama from the ridge overlooking Orange Field springs.
Anya was here in Uzon in 2005, except a few weeks later in the year. In her pictures from that expedition, the whole caldera looks like it's been set afire as the hardwood brush gets ready to drop its leaves.
The other thing that puzzles me was how few birds there are. The caldera is bursting with blueberries and mosquitoes, and yet I've seen only one swallow and heard not a single songbird. Meadows in California with a tenth the productivity (i.e., insects, fruit and seeds) are usually crammed with swallows, starlings (introduced, of course), jays, finches and songbirds. In Uzon, there are only a few white, long-winged birds with V-shaped tails that fly low and fast above the streams. They look a bit like a quarter-scale seagull, but re-engineered for speed and extreme distance-flying. They have bodies built like marathon runners, so I suppose Uzon must be a quick stop on a long journey for them. I've only seen two or three of these on a given day so far.
The lack of birds, especially songbirds, and the lack of pollinators are probably related. The winter in Kamchatka is too harsh for most birds to overwinter, so most birds found here would be migratory. Insects are ideal diet for a long-distance migratory birds, and they need lots of them to build up enough fat reserves for their world-crossing journeys. Maybe our timing is off, and we've just missed the migratory birds, or maybe they will arrive later when the blueberries are riper, or when their favorite species of insect reaches its crescendo. Or, perhaps the birds that used to come here are gone, their migratory route destroyed by a parking lot in a faraway place.
A carnivorous plant waits for the arrival of small, unlucky insects on the bank of Orange Field springs.
Karnosky National Biosphere Preserve is for Russia what Yellowstone, Yosemite and the Grand Canyon are to America. It is perhaps the single most beloved natural site in this vast country, and the people who have studied and explored it are heroes in Russia (they should be heroes worldwide). Tatiana Ustinova, who discovered the Valley of the Geysers, could be the John Muir of Russia. I'm sure that someone has studied the songbirds in Uzon, or lack thereof, just as the songbirds of Yosemite have been meticulously studied. However, Ustinova only discovered the Valley of the Geysers in 1941, whereas Yosemite and Hetch Hetchy were well known to the world more than a hundred years prior.
The problem, I think, is the disconnect of the scientific literature among countries. Before I left for Kamchatka, I looked for books like John Muir Laws' beautifully illustrated field guide to the plants, fungi and animals of the Sierras, but I could not find anything. My questions have probably been asked and answered, but only in Russian, and probably only in journals far from the beaten path.
I hope that this will change.
Debris left over from Karpov's old house (I think), which was heated by geothermal power. I'm holding the auger used to drill the well.
At Orange Field, Alex and Anna collected several samples for their colleagues at the Russian Academy of Science. We spent about two hours roaming around and waiving Anna's GPS at the sky, trying to pinpoint which spring was which. This is an uncertain proposition in a place like Uzon, which is subject to the vicissitudes snow, snowmelt erosion, the dynamic processes of volcanism, and curious bears that like to dig holes.
Team Russia, for the win!
When we got back, we ran the generator for a while so Sarah could do her DNA extractions. I used the opportunity to work on metagenomic analysis for Arkashin and Zavarzin a bit, organize photos, assemble some panoramas, and edit the last couple of days of blog entries. I also got in some really excellent procrastination on finishing my talk. I squished one hundred and sixteen mosquitoes and three biting black flies.
Anna made Borscht for us again, and it was, if anything, even more delicious than her previous Borscht. Same ingredients, same pot, same stove, same sour cream. I am puzzled, but that seems to be my lot in life.
Uzon, Day Four
It was very cold, wet and windy this morning, and I had a rough time getting started. A double shot of espresso helped, but it took a brisk hike to Burlyaschy to collect my first samples of the expedition to actually wake up.
Collecting sediment samples from the outflow of Burlyaschy (Boiling Spring). This is my first field sample since starting grad school. Neat!
Frank and I thought it might be interesting to try to sample from the center of the spring near the heat source, so we tied a 50ml tube and a rock to a rope and dragged it across the bottom of the pool a few times. It didn't work, unfortunately, so we're going to try using a long tube and a hand pump tomorrow.
Our improvised sampling gadget. It didn't work unfortunately. The bottom of Burlyaschy evidently doesn't have any sediment.
Our efforts were interrupted by a bear, a real one this time, that wandered out from behind a hummock about fifty feet away. We dropped what we were doing and circled to the bank of Burlyaschy opposite the bear. In principle, we could sidle in one direction or the other to keep the spring between us and the bear. A bear can easily outrun a human in a straight line, but on a turn, particularly in boiling mud, we have a better chance. If it tried to cross the pool, we would quickly end up with a few thousand gallons of bear-and-microbe soup.
A bear interrupted our work at Burlyaschy.
Happily, the bear showed little interest in us, and wandered off. It doesn't make for great photography, but I've decided that the preferred view of a bear is the posterior as it walks away.
Fortunately, he showed very little interest in us.
We returned to the station without incident and had some lunch. Alex and Anna went off to collect some samples for their colleagues in Moscow, while Frank and Bo packed up his computer, a huge APC power supply, and his scanning voltometry apparatus lumbered off to Red White and Green. Right now, Sarah and I are upstairs with the Russian expedition to use the lab bench for DNA extractions.
Sarah working on DNA extractions.
Later on, the weather cleared up to reveal an extrodinary afternoon. I was persuaded to go to so-called Bath Pool with the Russians. I'm not sure if I am any cleaner as a result, but the experience was... interesting.
Anna and Alex returning from Central Thermal Field.
Uzon, Day Three
Anna at Central Thermal Field. As the ranking Russian in our group, she is our chief scientist for this field expedition.
We awoke to heavy fog and rain this morning, and it was very cold. I went with Alex, Anna and Frank on a long hike to a group of petroleum-bearing springs. Along the way, we stopped at Boiling Spring (Burlyaschy in Russian), which really is boiling. We measured 96C near the edge, and it's about the size of a backyard swimming pool!
Boiling Spring.
Frank suggested on the walk back a few hours later that Boiling Spring might be an interesting metagenomic target; it's surrounded by extremely acidic formations -- we measured pH of 0.8 at one of them -- and yet Boiling Spring itself is at pH 7. It's likely to be relatively isolated from the surrounding environments. Because Uzon is much nearer to sea level than Yellowstone (650 meters, according to my phone), it's actually possible to find water at nearly 100C at the surface here. This suggests that it could be a good place to look for high temperature chemoautotrophs. Boiling Spring is also nearby an area known to be rich in petroleum sediments, so there could be high-temperature hydrocarbon utilizers too.
A petroileum-rich spring.
We then proceeded on to what Frank calls "the oil fields," where Alex, Frank and Anna took some more samples. There is a talk scheduled later at the Thermophiles Workshop by S.D. Varfolomeev called "The youngest oil on earth (Uzon, Kamchatka)," presenting evidence that there is petroleum at Uzon that is less than 50 years old!
Given the name "Oil Fields," I was expecting it to resemble La Brea Tar Pits in Los Angeles. I spent a lot of time at the Page Museum when I was young, so many of my formative experiences involved mammoths and smiladons and lakes of bubbling tar. I caught a few whiffs of that smell, but it was mostly the usual hotspring rotten-eggs.
We passed the ranger station on the way back, around three o'clock in the afternoon.
Around three o'clock, the rain finally let up enough for me to crawl out of my cheap yellow poncho. We ate a little bread and cheese we brought with us (and a chocolate bar, of course), and started hiking back toward the station. Along the way, we stopped to check on Frank's slides at K4 Well and then back to Red White and Green. Frank and Alex left some enrichment cultures to incubate at Red White and Green and another nearby spring with a very high temperature.
Alex and Anna wanted to keep working in the area, and so Frank and I hiked back to the station.
There was a tetrahedron of milk we opened for breakfast coffee, so I used it up to make an onion, garlic and dill fritatta for the two of us, and we talked some more about what might be living in the outflow from Boiling spring.
Alex and Anna eventually got back, and Anna made some scrambled eggs, and the ranger (Evgenij) joined us for lunch.
We spent the afternoon struggling to charge UPS for Bo's scanning voltometry gear. Balky generators and rain make a poor mix.
While that was going on, Bo, Albert and Sarah went to Burlyaschy (Boiling Spring). Albert spotted a mother bear with a cub nearby and moving toward them, so he readied one of our flare torches to scare them away. Before igniting the torch, Albert tried shouting a bit, and took a few steps toward the bears. The bears suddenly revealed themselves to be bushes in the fog, rattling in the wind.
Uzon, Day Two
It was cold and cloudy today, which is actually a blessing. We have to walk around in thigh-high rubber boots and stand around boiling pots of sulfurous water, and the mosquitoes are murderous.
I think I've got the hang of making a decent espresso in the field, at least with this incredibly delicious water. I found an adapter in an outdoor store in Petropavlovsk that mates the valve socket for my camping stove to cheap cans of cooking gas available practically everywhere. Unfortunately, the cans are completely unstable with any sort of pot or pan sitting on the stove, so I braced the can with some bricks from an old cook fire.
Some espresso on a cold, wet morning.
I packed light, which means that tomorrow I'll be on my last pair of clean pants. Tomorrow I will have to do laundry.
This morning we visited Arkashin spring, which is the other sampling site for the metagenomic data I've been analyzing. It's loaded with realgar (arsenic sulphide), and so it's expected to be full of species that are resistant to the various forms of arsenic, arsenide, arsenate, and possibly arsenic respiring organisms. Alex and Sarah took some samples of the sediment.
Arkashin Spring, one of my metagenomic targets.
We also spent a lot of time looking at a nearby site called K4 well, which is the remains of an old exploratory well drilled sixteen meters into Central Thermal Field. As you can see, the steel has been pretty much destroyed by corrosive hydrogen sulphide gas. The interesting thing about K4 is that the outflow starts out as a mix of steam and boiling water at about 100C, and cools off to about 40C over a space of about three meters. As a result, the organisms that live in each temperature band between 100C and 40C are organized into stripes following the contours of the isotherms.
K4 Well, a possible site for investigating spacial organization of microbes.
Frank and Albert inserted some microscope slides into the flow (if you leave them there for a while, the microbial mat will incorporate the slide which you can then remove to study). I'm very interested in studying this sort of spacial organization, and so Frank gave me a slide to insert transecting three of these bands. Glass is a good conductor of heat, and so I'm not very confident that it will work.
On the way back to the station, we came across a very interesting pool that Albert thought would be a perfect for Bo to try out his electrochemical instruments. Bo didn't come with us for the morning trip because he was still polishing, plating and testing the electrodes for his setup. There obviously isn't any cell phone reception out here in Uzon, but my little Android phone still makes a really great field GPS. I marked the coordinates for the pool as "Red White and Green" (sadly, there was no blue).
For lunch, we had buckwheat with tomato sauce, green peas and tofu (the carnivores added their canned mystery meat). It tasted great, but the buckwheat didn't agree with me at all. I took some anti-acid tablets, and then passed out for an hour. I woke up a bit overwhelmed by the taste of buckwheat and hydrogen sulfide (for some reason, whenever I smell hydrogen sulphide, I seem to keep smelling and tasting it for a long time afterward). Bo still had to work on his electrodes for a while longer, and so I sat around with a cup of tea and waited for the afternoon trip.
Bo packed up his electrodes, data acquisition system, laptop and portable power supply into a huge backpack/duffel, and I guided everyone back to Red White and Green. The Android phone worked great as a field GPS.
Bo getting his first scanning voltammetry data.
This is some of Bo's data from the field. The peaks and dips represent changes in current detected passing from one electrode to the other (in the presence of a reference) as the voltage was swept from zero to -2V and back. The cathodes are made of gold wire plated with mercury film (sort of like old-fashioned dental fillings), and the anode is elemental platinum. Scanning voltammetry is also known as cyclic voltammetry; the trace on the bottom is the return signal when the voltage swept back to zero. In the order they appear in the scan, Bo's first guess as to the identity of each dissolved compound are as following; thiosulphate, hydrogen sulphide, iron sulphide, hydrogen peroxide, iron (or maybe manganese) (II)+, and on the return scan, acid volatile sulphide (AVS).
The software Bo uses to drive the probes is a little crusty, so I decided to help him out with a little Python/Matplotlib awesomeness.
One of Bo's voltammetry scans; the annotations are based on Bo and Albert's experience with the technique and their best judgment while in the field; this is not their "final" conclusion about the water chemistry. As the science goes, think of this as somewhere between raw ingredients and the finished product, like bowl of cake batter.
When we got back, I cooked dinner; pasta with corn, onions Lithuanian-style cheese and some Georgian spice mix. The carnivores added a mysterious can of meat with a picture of a cow on it.
I went outside this evening to send a twitter update with the Iridium phone, and I thought I was safe from the swarming mosquitoes in my bug suit and thick socks. When I say "swarm," I really mean it. As I stood on the boardwalk, it sounded exactly like a 2010 World Cup game, complete with vuvuzelas. I miscalculated badly, and I got twenty-nine bites on my feet -- through my hiking socks -- in the three minutes I was standing still. I didn't notice until my feet started burning, like the way your mouth burns when you eat a chili pepper. I ran inside and dunked my feet in a bucket of near-freezing stream water until the burning stopped. Then soap and more freezing water, topical astringent, and three antihistamine pills. I have a little bit of swelling, but hopefully not enough to stop me from getting out tomorrow.
To my delight, the entomologist staying here decided this was a great evening to take some samples of her own. She fired up the generator and put a huge flood light on the upstairs portico. Then she used sweep nets to capture bucketloads of mosquitoes, which she preserved in formaldehyde (or something of the sort). It warmed my heart to see that.
Before heading to bed, I figured out how to bathe with three liters of water. The pump is broken, and so if you want water, you have to lug it from the stream, and if you want hot water, you have to use the tea kettle.
Uzon, Day One
A bear visiting the research station on our first day in Uzon. That boardwalk is the path to our outhouse; this was shot with a short lens from the kitchen porch.
This is why we carry signal flares to the toilet, and only go in groups.
After watching the bear wander off to forage for blueberries (which are everywhere), I sat down on the little bridge and made myself a cup of espresso from the stream water. The Russian team upstairs tells me that when they've tested it, it came back almost as clean as the molecular-grade water they brought with them. It was the best damn espresso I've ever had.
Espresso.
Preparations for sampling and measurements proceeded in fits and starts through the morning as Albert, Frank and Anna hammered out a plan for each day of the expedition. While that was going on, Bo, Sarah and I continued unpacking and organizing the gear.
I attempted to shave at the stream, but this did not go as well as the espresso. Hot water is important for shaving, and I didn't make enough of it. The stream is only seven degrees Celsius, which I discovered is utterly unsuitable for shaving.
Shaving did not go so well.
Around ten o'clock, the ranger took us on a tour of the thermal fields. Frank and Albert have been here several times of course, but the fields are never quite the same year-to-year. In 2008, for example, a geyser popped up near the ranger station; Uzon is not known to have geysers.
Zavarzin, one of my metagenomic targets. Alex is measuring the temperature, and we worked around some enrichment cultures set up by another research team.
We stopped by Zavarzin Spring along the way, which was particularly interesting for me. For the last few months, I've been analyzing some metagenomic data taken from Zavarzin a few years ago as part of the Tree of Life project. Until today, Zavarzin was just a FASTA file containing about ten thousand Sanger reads, like so :
>ZAVAK94TR 6000 12000 9000 21 953 GTAGCTGTAAGGGCGGGGAGGGCTCACCTGGTCCCGGCCTTCGACGGCGGCCCCAATCCG GCCAGCGCCCAGGCCCTCACCGAAGTCGAAGCCTACGCCTTTTCCTGTTCCGATTTCCGG AAACTGATAGGGGAGTTCCCCCGGATTGCCGGCAATATCCTGGCCGATTTTGCCGCCAAA TTGCGCCTGCTGGTAGGGCTGGTGGAGGACCTCTCCTTCCGTACGGTGGAGGCGCGTCTG GCCCGTTTCCTCCTGAGCCGGGATGTGGCCGTGCCCGGCCGGCGCTGGACCCAGGAGGAG ATGGCCGCCCACCTGGGCACGGTGCGCGAGGTGGTCGGCCGAGTGCTTCGGGCCTGGCGT GAGGAGGGTCTGATTCGCCAGGAACGCGGCCGCATCGTCATCCTGGACCGGGCCGCGCTG GAGAAGAAGGCTCAAATCTGACATCATTCGTGCCAGGACGAGTTATGCAAAGATGTCAGG AAAAAGGACTTTTTGACAAAGAGAGGGGAATATGCTACATTGTCAGCCCCGGAGGGCCGG CCCGCATGGACCAACCGCATCCGGGTGACCCGAAAGGCAGAAACGTTCGGGCAGGCTGAT GATGGACACGTTCCGCGCCATCCGTCGGGTCCTCTGGATCACGATGGGGCTCAACCTTCT GGCTATGGCGGCCAAACTGGGCGTGGGCTACCTCACCGGCTCCCTCAGCCTGGTCGCCGA CGGCTTCGATTCGGCCTTTGACGGTGCCTCCAACGTGGTGGGGCTGGTGGGGATTTATCT GGCCGCCCGACCGGCCGACGAAGGCCACCCCTACGGCCACCGCAAGGCCGAAACCCTCAC CGCCCTGGGCGTCTCCGCCCTCCTCTTCCTGACGACCTGGGAACTGGTGAAGAGCGCGGT CGAGCGCCTGCGCGACCCGACTCGGATACAGGCCGAGGTCACGGTCTGGAGTTTCGGGGC CCTCGTCCTCAGCATCCTGGTGCACGCGACCGTGGTCTGGTACGAGATGCGGGAGGGCCG GCGGTTGAGGAGCGATTTCCTGGTGGCCGATGCCCAGCACACAfter so much time working on this data, it was pretty exciting to see the actual site.
I came back to the research station with Albert and Bo, and I fixed some lunch for everyone (apples and pears with Nutella, cheese and black bread, olives, some cucumbers sliced with lemon and dill, and the ubiquitous Russian sausage for the meat eaters).
After lunch, everyone except Bo went back to Zavarzin (Bo stayed at the station to work on the electrodes for his instrument). Albert and Sarah took measurements and tried out some home-made core samplers, and Anna and Alex started some enrichment cultures. This was a preliminary trip, so I mostly just tried to stay out of the way. I got some nice photographs of the rather extraordinary microbial mats growing in the smaller springs nearby.
I mentioned in a previous post that volcanic liquids are very diverse; this is the reason it's worth traveling all the way to Kamchatka. Here is a nice example of what I was talking about. These are three springs within about four feet of each other. You can see just by looking at them that they are different. The colors range from in clear to white to gray, indicating different redox states (probably of sulfur); the temperature ranges from 91C, to 86C to 81C, and the pH from 7 to 5.6 to 6.1.
Three adjacent yet very different springs.
That might not sound particularly dramatic, but recall that when you catch a fever, the shift from 37 degrees to 39 degrees is enough to halt the growth of a wide array of organisms. This is why fever is a response to infection. Microbes often adapt to very particular circumstances, and so a change of a few degrees can shift the ecology dramatically, or replace it altogether. As environments, these three springs are as different from each other as the inside of your mouth and the eyelid of a duck.
We finished up with our poking around at Zavarzin, and came home for a dinner of Borscht prepared by Anna. It was delicious. After dinner, we started setting up our lab space upstairs for DNA extractions. I managed to trip the breaker on the generator several times trying to charge up the UPSs.
Updates, continuing
The speaking docket got shuffled around a lot, and I ended up having to give my talk much earlier than planned. I suppose this is the inevitable downside of procrastination. While I was scrambling to finish it, I didn't have much time for blog updates!
I survived the talk. There were lots and lots of excellent questions, and I have a lot to think about now. Anyway, back to the updates from Uzon.
Uzon, Day Zero
The discovery of the valley is an adventure all unto itself -- beginning with a dogsled trip that got off track and ending up with the discovery of first hydrothermal site in Russia. Tatiana, who eventually settled in Vancouver, passed away recently. Her family was aboard our helicopter on a visit in her memory to Geyser Valley. Her valley, one could say.
Frank spent much of our time in Petropavlovsk regaling us with stories of helicopters left over from Russia's war in Afghanistan and held together with bits of string. If our helicopter was that old, it has been lovingly maintained.
Our ride to Uzon touching down at the airfield.
I was expecting the ride itself to be exciting, but there is none of the rush and acceleration of an airplane takeoff; when a helicopter takes off, it gets very, very loud, and rises with all the grace and charm of a freight elevator. The excitement came entirely from the view out the portal, which we could open. Kronotsky Nature Preserve is spectacularly beautiful from any angle; as interesting as it was to see it from the air, I kept wishing we would land so I could get out and have a look around.
The view from the helicopter portal as we entered Kronotsky Nature Preserve.
I lost track of how many volcanoes we passed. The most exciting was Karimsky, which happened to erupt just as I snapped a picture of it!
Karymsky Volcano erupting as we fly nearby.
Actually, I didn't take this picture. There was a photographer sitting next to me using the same portal, and I had asked him to snap a few shots of Karimsky -- which was not erupting at the time -- because he had a better angle from were he was sitting. He snapped one shot of the volcano and gasped, and then dropped my camera in his lap and grabbed his own.
Karymsky Volcano erupting as we fly nearby.
Eruption of Karymsky Volcano continues as we fly over an inland delta.
We touched down in Uzon Caldera a few minutes later, and immediately ran into some confusion over accommodations. There are two buildings in Uzon Caldera; a ranger station, and the research station. The structures are each about the size of a modest single family home. There was already a team from Winigradsky Institute staying at the research station (the director, actually), as well as the ranger and an entomologist. Meanwhile, the ranger station is being renovated, and the work crew is staying there.
Our ride continuing on to Geyser Vally. The family of Tatiana Ustinova were aboard.
The helicopter crew had been told that we would be staying at the ranger station for some reason, and so the earlier flight had delivered all of our food and lab equipment to the landing pad nearest the ranger station. The ranger station is about a kilometer away from the research station, and so we had to schlep all thirteen boxes of lab equipment and four heavy boxes of food.
Shifting our food and lab equipment from the ranger station to the research station. It was a long and exhausting job.
Once installed at the research station, Sarah, Bo and I organized our gear and luggage, and Frank and Albert -- dead tired, like the rest of us -- went upstairs bearing gifts to make friends with the other research team.
We rehydrated some freeze-dried pasta primavera, to which Sara and I added tofu. I was too hungry to notice what everyone else ate, but I think sausage was involved. Then we passed out.
Back from Uzon
Panorama overlooking Orange Fields in Uzon Caldera
We just arrived back in Petropavlovsk after a week in the field. I was very sad to leave Uzon, and it was a privilege and an honor of the highest order to have spent those days there.
The expedition was, I think, a great success. We'll know for sure once we're back at our labs and can use more sophisticated methods to examine our samples. I am very confident, though.
It was a bit touch-and-go right at the end. Our high speed centrifuge crapped out last night, just as Sarah was in the middle of the last big run of DNA extractions. The Russian team brought their own centrifuge, but we couldn't run it on our generator. Much to our relief, Albert was able to magically get the thing working again by holding it at just the right angle. They worked through the night to finish processing the samples; I think Albert must have had his thumb wedged under the centrifuge for the entire run.
I'm sorry I wasn't able to send many Twitter updates toward the end of the expedition. Once I had identified my sampling targets, I suddenly had a lot less free time on my hands (and I didn't have much to begin with). Also, I'm sorry for updating in ALL CAPS. Iridium handsets are essentially 1993 technology. Composing text messages is extremely painful, and the battery only lasts long enough to compose two or three of them. This is a pain when you have to recharge on generator power, and the generator only cranks up for a few hours a night, and even then only to power lab equipment for DNA extractions. Hats off to my dad for relaying the messages!
Right now, I'm sitting in a friendly internet cafe in Petropavlovsk where they've let me use their wireless connection. When we arrived at our crowded little apartment, the hot water was broken, and thus no showers yet. A wide selection of interesting geologic samples are wedged under my fingernails, and I think I have wads of some sort of hardened liquid sulfur caked in my hair. The helicopter arrived ridiculously early, and we just barely get everything aboard. As a result, I'm still wearing my field clothes from yesterday, which are splattered with volcanic mud. I may actually be the worst-smelling person in Petropavlovsk. Perhaps it is fortunate that this internet cafe caters mainly to kids playing StarCraft.
I composed blog entries for each day we were in Uzon, and I'll be posting them as soon as I run them past the rest of the team. I also have almost two thousand photos to sort, tag and upload.
That said, I have a correction for one of my Twitter updates. I wrote :
YERTERDAY ALBERT & TEAM WERE CHASED AWAY FROM A SITE BY A BEAR THAT WAS ACTUALY A BUSH IN THE FOG.Albert pointed out that they were interrupted for a few minutes, but not actually chased away. He stepped forward and shouted see if he bear (or bears) would go away, with his signal torch uncapped and ready. The bears were revealed to be bushes as the wind shifted and created a channel in the mist. It's funny, but given how foggy it was that day, it wasn't actually that surprising. We were at the same site the next day, and were surprised by an actual bear. It wandered pretty close to us before we could actually see it (the full story will come with the article for that day).
A bear interrupting important EisenLab work at Boiling Spring.
Update : Albert also says that I'm wrong about having to wedge his thumb under the centrifuge the whole time. It started working again after shaking it around in the air a bit, and placing it just so on the table. He only had his thumb wedged underneath it for a minute or two to check to see if it was overheating.
Last minute preparations
We had an exhausting day yesterday.
First, the cost of the helicopter has gone up since last time they made the trip, so Frank and Albert had to arrange to transfer the difference from America to Petropavlovsk. This turned out to be an agonizing process, and I'm not even sure of all the details. Albert came back to the apartment after the first day of working on it and passed out instantly. Suffice it to say that both of them have extremely patient and resourceful spouses, without whom we would now be stranded in town with no way to get to our research site.
There remains a great deal of confusion and uncertainty about the status of the generator (or generators?) at Uzon, and so we've had to prepare for the worst. I spent the day with Albert and Alex hunting down motor oil, spark plugs, and two-stroke oil (in case it's a two-stroke engine), and other small-engine stuff. Supposedly there is a new American-market Honda generator up there, a Soviet-era machine that can still be persuaded to work, and perhaps something else of unknown providence and status. We were also told that there was no generator at all, sending us scrambling all over town to buy a new generator, but that was evidently a misscommunication. Fortunately we got it straightened out before we actually started laying out Rubles for the first generator we could carry away!
In the summertime, the research station would be a truly ideal place for an off-grid solar array. One of the things I'm going to do while I'm there is to study the structure an write up a proposal for its owners to install one, if they should so desire.
After much looking around I found that, nobody sells regular fuel canisters for backpacking stoves in this part of Russia. However, they do sell adapters that let you plug them into butane refill canisters. The canisters are very cheap, but they are shaped like cans of hairspray; narrow and tall. Not a very stable platform for cooking! I'm going to set up my stove in a bucket, and pack dirt around the fuel canister to keep it stable and upright (and far from anything that might melt or burn). And yes, I'll only use it outside.
Demonstrating the use of mosquito protection gear for Bo -- you can tell I'm not really excited about mosquitoes
I was able to find a SIM card for my MyTouch 3G, which is awesome. Unfortunately, MTS doesn't know how to automatically configure Android phones for GPRS. At least, that's what I could understand from the girl at the MTS store. That conversation was conducted mostly through hand gestures and giggling, and was a testament to the power of technology-related acronyms to puncture language barriers. It's strange to say, "IP for DNS server?" and see the light of understanding spread across a person's face.
We bought more than 15,000 Rubles of food for the trip! Actually, that's pretty reasonable for seven people.
Last of all, there was the food. By the time we all got to the grocery at 7:00 in the evening, we were almost totally spent. Still, we had to shop for another two hours before we had everything we need (at least, I hope we have everything we need).
This morning a truck from the Institute arrived at the apartment to pick up our food and laboratory equipment. We're not totally sure if we will be riding with it to Uzon, or if it will go on a separate helicopter. So, we had to waterproof everything last night in case it had to spend the day (or evening) on the landing site in the rain. I am glad we had plenty of plastic bags and tape!
Our food and lab equipment getting picked up
With luck, we will catch our helicopter to Uzon this evening.
Uzon field season team, 2010
Professor Frank T. Robb, University of Maryland
Frank is the co-chair of the workshop, and is leading our expedition. Frank is a regular in Uzon Caldera, and has made several expedition to the site since 1995.
Frank has been studying thermophiles for around twenty years, including their physiology, genomes, proteins, and ecology.
Professor Albert Colman, University of Chicago
Albert is organizing the expedition this year, and has accompanied Frank (and others) to Uzon several times. Albert was Frank's graduate student back in the day.
Alex Merkel, Winogradsky Institute of Microbiology
Alex graduated from Moscow State University, and is now a Ph.D. candidate at the Winogradsky Institute of Microbiology in Moscow. He is studying the functional diversity of methanogenic genes and culturing methane producing microorganisms.
He is also secretly the lead singer from Coldplay.
Anna Perevalova, Moscow State University
Anna graduated from Moscow State University and obtained her Ph.D. from Winogradsky Institute of Microbiology in Moscow. She is now a postdoctoral researcher at Winogradsky. Her specialty is growing extremely difficult organisms, and she also works with Alex on methanogens.
Sarah Griffis, Caltech and University of Chicago
Sarah is a senior at Caltech, and has been working in Albert's lab in Chicago for the summer doing DNA extractions.
Bo He, University of Chicago
Bo is a graduate student in Albert's lab; he studies the electochemistry of cellular redox metabolism, particularly as it pertains to metal chemistry. He did his MS at Chapel Hill on the kinetics of iron III and hydrogen sulphide in sediment formation. It's nice to have someone with a physical sciences background along for the trip!
Russell Neches, University of California, Davis
And, of course, me.
Live from Petropavlovsk
Singlehandedly bringing PLoS to new frontiers!
I arrived safely in Petropavlovsk yesterday after a very long layover in Khabarovsk and an even longer layover in Vladivostok. Frank Robb and Alex Merkel met me at the gate, and we wobbled off with our driver to the Volcanology Institute to file my paperwork.
Beer! Where have you been all this time?
After dropping my stuff off at the apartment, Frank took everyone out for pizza. Airport and airline food in Russia leaves a bit to be desired, especially if you are vegetarian and don't speak Russian. Pretty much everything is covered in, stuffed with, or made entirely out of sausages.
I basically hadn't had anything to eat in 24 hours, so I was extremely glad to get my hands on the pizza (I ate almost two). The beer was also extremely welcome.
Fog, cursed fog.
Unfortunately, Petropavlovsk is fogged in with what everyone keeps caling a "cyclone," but I don't think the word is used in the same sense as I'm used to. It seems to be a huge fog bank with drizzle coming in from the ocean. The helicopters we will fly to Uzon Caldera are fly-by-sight, so we're grounded in Petropavlovsk until the weather clears.
For now, it's seven scientists crammed into a tiny one-bedroom Soviet era apartment with a dozen laptops, piles of camping gear, and two whole laboratories (one for geochemistry, one for recombinant DNA) stuffed into freight boxes. Time to go exploring...
The door to Petropavlovsk; due for a little maintenance
Kamchatka for those who've never played Risk
Anyone who's played Risk will probably remember Kamchatka as "That place you can attack Alaska from." Like most of the territories in Risk, Kamchatka of the Hasbro game doesn't exactly match its modern political boundaries :
However, the Risk territory does reflect the range of the Chukotko-Kamchatkan language family, which includes the language spoken by the Koryaks (Kamchatka's indigenous people) :
400,000 people live on the peninsula, and about 13,000 are Koryak (about 3%). For comparison, Alaska has about 686,000 people, of which roughly 100,000 (15%) are native peoples. In terms of population, the Koryaks' situation more closely resembles that of the Ainu of Hokkaido (also about 3% of the population, going by self-identification) than native Alaskans.
Kamchatka has volcanoes. Lots and lots of volcanoes. It's part of the Ring of Fire, with 160 volcanoes, 29 of which are active. The whole area is seismically active, and there was a decent-size quake off the coast just this Sunday.
Phil Plait at Bad Astronomy posted about an this awesome photo of two Kamchatkan volcanoes erupting at the same time. It was captured in February, 2010 by NASA's TERRA Earth-observing satellite as it flew over (the TERRA website appears to be down right now - this isn't rocket science, NASA!).
These volcanoes, and the microbes that live in and around them, are the reason why we're traveling around the world to see this place. Wherever magma is close enough to the surface to interact with groundwater, superheated steam can be forced toward the surface. Depending on the how much it cools before reaching the surface and the pressure under which it emerges, the liquid can for a variety of hydrothermal features; geysers, fumaroles and springs if the liquid emerges on land, and black smokers and white smokers if it emerges under water.
Along the way, the water dissolves various minerals and gases from the rock, and catalyzes the formation of new minerals and gases. By the time it emerges at the surface, it has become a complex suspension of minerals, gases and liquids, some dissolved, others suspended as a colloid, and others in bubbles and grains. I'm going to stop calling it "water" and call this stuff "volcanic liquid."
The chemistry of the emerging liquid depends on the chemistry, temperature, depth, thickness, packing and order of each layer of rock and soil it transits on the way to the surface, as well as the pressure and temperature of the liquid at each step along its journey.
A thermal pool at Lassen Volcanic National Park
My favorite way to explain how there could be so much variety in volcanic liquids is to think about coffee. It's possible to make several very different kinds of coffee from the same beans. If you grind them very fine, pack them tightly, and force steam through the grounds at high pressure, you get espresso. If you grind them even finer and suspend them in hot water as a colloid, you get Turkish coffee. If you grind them coarsely, suspend them in water, and remove them with a sieve, you get French-style coffee. If you grind them moderately, put them in a filter cone, and pour hot water through them, you get American-style drip coffee. They each taste totally different, despite being made from exactly the same ingredients.
Now, instead of coffee grounds, imagine many layers of rock, each with different chemistry, packing density, and thickness. Rocks, by the way, are pretty complicated things, and can be made out of almost anything. Practically every source of volcanic liquid from around the world has a unique chemical composition.
This variety is one of the reasons microbiologists are so interested in the organisms that live in these liquids. Organisms that live in the Earth's atmosphere, like you and me, have only a few attractive options for how we run our metabolisms. For organisms that live in volcanic liquids, every combination of dissolved and suspended minerals and gases offers its own unique metabolic opportunities. Volcanic structures tend to persist for a long time, and so their denizens have time to evolve very well-adapted strategies for living in these places.
Visiting these volcanic vents is like taking a trip to an alien world, or like visiting Earth when it was a radically different planet. Volcanic zones don't just look alien, they are alien!
An alien habitat at Lassen Volcanic National Park
I will be spending almost two weeks up-close-and-personal with some of these alien habitats, so there will be more to come.
Science, the practice of
This is the first in a series of articles I plan to write over the next three weeks covering my field expedition to Uzon Caldera and attendance the 2010 International Workshop on Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles. In this post, I'll outline my plans for the series and explain why I'm writing it.
If you would like to follow along, check in here, or subscribe to my RSS feed. Or if you would like to follow the series and not the rest of my blog, I will be tagging all of the posts in the series kamchatka. At Uzon Caldera, I will be posting updates to my Twitter feed by satellite phone (you can also subscribe to my Twitter RSS feed.)
Before I leave on Tuesday, I will post articles introducing the natural history of Kamchatka, my plans and preparations for getting getting there and working there, and maybe a few other things.
I have two broad goals :
- Study the biochemistry, genomics, and physiology of thermophilic organisms in their natural habitat.
- Document and share the experience.
The second mission is to bring you along. I've been asked by my thesis advisor to write about, photograph, tweet and film as much of the field expedition and the workshop as possible, and present it as an example of what it's like to actually do science. My goal is to present the company, the food, the work, the travel, the joys, the annoyances, the surprises, the good, the bad, and the ridiculous.
Science remains firmly misunderstood by the public. My personal experience suggests that the public actually understands the products of science -- powerful theories and key facts -- a bit better than polling data suggests. The core of public misunderstanding, I think, rests in how people believe science works as an institution and as a profession.
A couple of years ago, Fermilab invited a group of seventh graders to visit the laboratory to check out the various awesome things they have available for the public to see. Before the visit, the students were asked to write about what they thought scientists were like, and to draw a picture to go along with it. After the visit, they were asked to repeat the exercise. The results eye-opening. Here is an example I particularly liked, from a girl named Rachel :
before | after |
![]() |
![]() |
Most of the before pictures feature lab coats filled by older, white men without much hair. Many of the kids mentioned that they thought scientists were "a little bit crazy," and most represented their scientist as some sort of authority figure. The after-visit results are equally interesting; many of the comments seem astonished that scientists have families, and that they enjoy things other than science.
The phrase "regular people" comes up again and again in their after-visit writing. Students are usually pretty good at ignoring phrases that are deliberately emphasized. When you see a bunch students incorporate exactly the same phrase into a free-form writing assignment, it's usually something that an adult mentioned without anticipating the impact it would have. The concept that scientists could be "regular people" was evidently a bit of a shock.
Obviously this is anecdotal, and it's important not to read too much into it. It is, however, a useful example of the sort of challenges we face if we want society to understand science itself, rather than simply memorizing the things science produces. None of this is original to me. If you want an entertaining treatment of science in the media, check out Christopher Frayling's Mad, Bad and Dangerous?: The Scientist and the Cinema (I apologize for the bizarre question-mark colon thing).
I've written about this before. Last November, I wrote :
The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.Scientists have a responsibility to share what they do.
Over the next three weeks, I'm going to put that thought into action.
I'm going to Kamchatka!
I've been working on the analysis of environmental samples from two sites at Uzon Caldera (about 10,000 Sanger reads from each sequenced at the JGI), and I'm hoping that I'll be able to reprocess the DNA here at the UC Davis Genome Center using some of our high-throughput machines. Licensing and customs restrictions will probably make it impossible to bring my own samples back, but I may be able to entrust them to a colleague with fancier credentials than my own.
Insofar as it will be possible, I will be blogging from Kamchatka and uploading photographs and data, so please ask questions in the comments!
I'll be arriving in Petropavlovsk on the 30th of July, with the help of a generous grant from the Carnegie Institution for Science Deep Carbon Observatory.
A desirable extinction
Oddly, the fleas don't seem to like Neil very much, nor do they like me. It's just poor Buzz that's beset by the nasty little critters.
Figure 1: A flea.
As it happens, I've been thinking about endogenous metrics for estimating the sampling quality of an environmental shotgun sequencing dataset, and Buzz's little problem presented an opportunity to play with a simplified problem. So, I have decided to make Buzz, or rather his fleas, into a small experiment in ecology. I am going to try to see if I can drive them into extinction.
Now, this is normally what a pet owner does when they discover their pet has contracted some sort of annoying parasite, but I decided to take a more quantitative approach.
Figure 2: A cat.
It's simple enough to count fleas on a cat, if the cat is willing to cooperate. Buzz loves the flea comb, and will gleefully hop onto the coffee table and wait to be combed if you show it to him. So, in the interest of science, I convinced my roommate to count the number of passes I made with the flea comb and how many fleas I captured (posterity will remember your efforts, Mehdi). Using his tally, I plotted the cumulative number of passes verses the cumulative number of fleas.
Figure 3: Fleas captured
As expected, it became somewhat more difficult to capture the next flea as more fleas were captured, suggesting a depletion curve. The value of the asymptote should be the actual number of fleas on Buzz at the time, and reaching that number would imply local extinction for the fleas. Of course, there are probably other fleas lurking about that would recolonize Buzz. In principle, if I were to repeat the exercise frequently enough, Buzz would become a sink for fleas, and their migration to his fur would gradually deplete them from the environment.
There are a couple of different ways to model the impact of the combing on the flea population, with various advantages and disadvantages. All we really want to do here is to estimate the value of the asymptote, and so a simple model is probably sufficient. I showed this data to my fried Sharon Shewmake, an economics graduate student. Sharon, after editorializing on the endeavor ("Ew."), suggested this very simple model.
Assume that Buzz is not going to sit still long enough for the fleas to reproduce, for more fleas to migrate to his fur, and that the fleas already on his fur are going to stay put unless captured. Thus, there is a fixed initial population which only changes as a result of capturing fleas. Next, we assume that any given flea is equally likely to be captured on a single pass of the comb. So, the expectation value for number of fleas captured on a single pass is the product of the current population and the probability of capturing a flea.
where N is the population of fleas and p is the probability of any particular flea being captured on a single pass. One could tart this up a bit by modeling it as a stochastic process and executing a bunch of Monte Carlo trials until the outcomes converge, but that seems like overkill for a simple single variable problem like this. We will put up with the intellectual inconvenience of capturing fractional fleas.
This is a little easier to see if we let N represent the number of fleas remaining on the cat, rather than the number of fleas captured.
If we stretch our credulity far enough to imagine this as a continuous function, we can express it as a differential equation.
Sorry if this bothers you. Not only are we extracting fractional fleas, but we are now modeling the combing process as a sort of flea-killing-combine continuously mowing its way through the fur. This is a model, so you shouldn't be surprised to find massless rope and spherical cows. Anyway, it has a nice easy solution.
Well, what the heck. This is a decaying function, so let's pluck a minus sign out of the exponential factor, and maybe tack on a scale factor for the initial population.
While we're at it, why don't we go back to letting the function stand for the number of fleas captured, rather than the fleas on the cat.
This gives us a nice function to use for a linear regression. A little help from scipy, and we find that the initial population is estimated at 39.7 fleas, and the decay factor is 0.011.
Figure 4: Flea population
I captured 34 fleas, so that means I missed about five or six. In order to be reasonably confident that I'd captured all 39 fleas, I would have had to continued for about 400 passes with the comb, instead of 173. Buzz is a patient cat, but he started to loose interest around 120 passes, and had to be fetched back onto the coffee table a few time times during the last 50 passes. My guess is that 400 passes would require some kind of sedative. On the other hand, he does seem to like Guinness, so there may be something to that.
Science has been served. I'm going to the pet store to buy some flea collars.
UC Davis, meet the internet.
So, the question of the evening is, does the UC Davis registrar know this?
Um... no.
This is a completely automated process. If you do this during the daytime, it just goes ahead and populates a table in whatever chthonic legacy database system that is swaddled in this blob of early 1990's vintage web programming. It's not like having the office open at the time actually helps.
Attention Amazon.com shoppers! It's 4:45 Central Time, and Amazon.com will be closing for the day in 15 minutes! Please complete your order before the site is disconnected for the evening. We will open again tomorrow at 8:30 A.M. Thank you for shopping at Amazon.com!
On the upside, at least it doesn't complain that my browser isn't supported. Yay.
First lab rotation
I tried to make the paper look like an PNAS article, but alas, their LaTeX template leaves much to be desired. I like how the talk turned out little better, thanks the wonderful Beamer package for LaTeX.
Speaking of science
One of the other issues we've been addressing in the seminar is how scientists relate to non-scientists. This is, for obvious reasons, an essential teaching skill. Even if they hope to be scientists someday, students are not scientists. If you don't find a way to talk with them about science, then you're wasting their money and their time.
The idea that the educator is largely responsible for the success (or failure) of the student hasn't really seeped into higher education, although it's been the standard thinking in primary and secondary education for decades. Not all elementary school teachers are good at what they do, but it is generally agreed that if they are good, the results will be seen in the subsequent success of their students. In higher education, things don't really work this way.
The most often cited reason for poor instruction at the college level is that many professors consider teaching secondary to their research. While this is clearly true in many cases, teaching in higher education doesn't just suffer from playing second fiddle to research. Many, many professors (even whole departments) who take teaching seriously are nevertheless not very good at it.
There are two causes, both of which are systemic problems. First of all, people who teach at the college level are usually not trained as teachers. Many (most?) professors have no education training whatsoever. Yet, even if you have natural skills, teaching isn't something you can do effectively without at least a little theory and training.
The result is that most of the teaching in colleges is done by amateurs and autodidacts. In contrast, at the primary and secondary level, teaching has been a job for trained professionals since the turn of the last century.
The second problem, which is partly a symptom of the first, is regular old-fashioned chauvinism. It is the responsibility of the student to learn, but many professors fail to see how they fit into this. This might be acceptable at a private, endowment-supported institution, but such places are exceptions. The Harvards and Oxfords of the world are free to treat their students however they like, but public institutions are ultimately responsible to the taxpayers. The taxpayers support such institutions for two reasons; to conduct research, and to educate their kids. Sink-or-swim pedagogy is a dereliction of duty.
This is a problem that extends far beyond the classroom. I was listening to NPR on the drive down to Los Angeles, and caught a story on All Things Considered about the reception of Darwin's On the Origin of Species. Some extracts :
"That fraction of people who figured that they could and should keep more or less up to date with what was happening in geology, in botany, in zoology, even in physics and mathematics is a much bigger fraction than it is today," says Steven Shapin, a Franklin L. Ford Professor of the History of Science at Harvard University....
"We hear about scientific findings," says Shapin. "But the proportion that can evaluate them and follow along with them, as opposed to hearing about them, is very, very small."
Shapin says that since people can't be completely conversant with the relevant science, "They're looking for an answer to the question, 'Who can we rely on? Who's speaking the truth? Who can we trust?' "
I think the good professor is missing the point. The problem is not simply that science has gotten more complicated and technical. It is true that there is more of it, and that it moves faster. The reason I don't buy Dr. Shapin's argument is that this is not at all unique to science. Everything moves faster and is more technical now than in 1859, and people seem to cope just fine.
The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.
Darwin's target audience for Origin -- the typical educated Briton in 1859 -- would not have much of an advantage on the average American in 2009. A Victorian gentleman would probably have had better handwriting and more patience for trudging through elliptical turns of phrase than an American high school graduate, but I don't think they would have much of advantage when it came to comprehending an unfamiliar scientific topic. The advantage Darwin's audience had was that it had Darwin.
When a good teacher notices that a student is failing to learn something, they will look first at their own teaching methodology for the problem. The same goes for scientists; when the general public doesn't understand or care about a scientific topic, a good scientist should look first at how they are publicizing their work. If the public doesn't think your research is important, then either you aren't explaining it well enough, or maybe it actually isn't very interesting.
Clones!
Yays!
My hacked up version of the gene gene is getting snipped up with everyone's favorite restriction enzymes (BamH1 and EcoR1). Then I get to splice it into a plasmid, and electroport the plasmids into some cells, and maybe they will do something interesing.
The cloning blues
- Wrecked a DNA extraction by grabbing the wrong Pipetter and putting 300 microliters into a tube instead of 3.
- Misread an illegible label and used butanol instead of ethanol, destroyed second attempt at the aforementioned DNA extraction.
- Dropped the wrong tube in the trash, screwed up the third attempt at the aforementioned DNA extraction.
- Kept a gel on the UV bench too long while trying to chop out little cubes with a razor blade, annihilated all the DNA, and screwed up fourth attempt at aforementioned DNA extraction.
- The PCR cycler didn't close correctly, and my reaction tubes evaporated; screwing up fifth attempt at aforementioned DNA extraction. (At least this one wasn't my fault.)
I definitely sticking to informatics -- that part of the rotation is going pretty well. I'm just not cut out for benchwork.
A busy month
Right now, I'm working with Andrey Kislyuk on our little piece of the DARPA FunBio project. We're in the middle of a two-week code sprint, so I'll save that for a later post.
I also moved to a new apartment, and that didn't go nearly as smoothly as it could have. The guy we subleased from was in the process of buying a house, and the loan underwriter decided to yank back the money after he'd closed escrow (or was in escrow, or something). Evidently they wanted a sworn affidavit from the gardener that he was contracted to take care of the grounds. Anyway, the upshot was that instead of a nice leisurely move, he got stuck in the apartment for three weeks longer than he expected, and I was homeless for a week. Fortunately, one of the staff scientists in our lab was generous enough to let me stay at his apartment. Neil and Buzz got to learn about stairs, which they evidently adore.
Over Labor Day weekend, I went with Srijak and some of his friends from San Diego on a day hike at Lassen Volcanic National Park. I've always loved California, but it's nice to be reminded from time to time exactly why I love this place so much.
Because it's awesome.
Second quarter at Davis
- Mathematical Methods : Laplace transforms, Fourier transforms, Greens functions, and their applications to partial differential equations.
- Quantum Mechanics: Again. For the heck of it.
- Numerical Methods: Analysis of the performance, stability and error propagation of numerical algorithms in finite precision systems.
The preliminary exam for mathematical methods is in the middle of finals week at the end of this quarter. That is going to suck.
First actual week of grad school
Tomorrow, I have a job interview and tour for an on-campus job working in one of the Department of Entomology greenhouses. Not quite as good as a TA position, but it would pay for rent and get me outside and moving around on a regular basis.
I still haven't found a place to live yet, but a very nice fellow from my department is letting me crash on his living room floor until I do. Classes were supposed to start Thursday, but evidently the professor for that course isn't here yet.


