Russell's Blog

When I registered for the workshop, the organizers asked me to give a 20 minute talk on my topic of research. I only just finished my coursework in May, so I didn't have a great deal of work to present (at least not in microbiology...).

So, I submitted an abstract titled, "Classification of environmental sequence data using multiple sources of inference." This project is a collaboration with Andrey Kislyuk, who has just graduated from Georgia Tech, supervised by Joshua Weitz. It's a pretty cool project, but Andrey has just graduated and moved on to Pacific Biosciences, so things haven't moved as quickly as I would have liked.

After the first day of talks, I started to get pretty nervous; I thought I would have some downtime during the field expedition to work on my slides. Downtime when Frank Robb, Albert Colman and Anna Perevalova are around? Ha! If I'd met them before walking off the airplane in Petropavlovsk, I would have known how ridiculous an idea that was.

To make matters worse, the organizers had to shift the schedule forward by a day because weather delayed the excursion to Uzon (which I was not planning to join, since I'd just spent a week there). Thus, I found myself in the position of giving and unfinished talk about an unfinished project. Worse, I was going to stand up and talk about probability theory and Bayesian priors to a roomfull of people who ride submarines into underwater volcanoes and discover whole new branches of Earthly life. Worse still, I had to follow Frank Robb's talk about isolating and sequencing organisms that grow on syngas, which he had to cut short because there was just too much awesome for one talk to hold.

To my surprise, I manged to finish the slides during lunch and the coffee break. Also to my surprise, I got a lot of really great questions, and lots of people seemed weirdly excited about the idea of using more than one mathematical technique for sifting through metagenomic data.

I've recently started working on one such analysis (a different project altogether), and I'm gaining an appreciation for just how difficult it is. Perhaps the interest in my talk has more to do with the fact that people in the field really, really want better tools, and there's a lot of enthusiasm for anything that looks halfway promising.

Also, I have to give a big thumbs up to the Russians (and other folks) who gave their talks in English. I once had to give a brief talk on physics in Japanese, and it was one of the most difficult, stressful experiences of my life. It was only five minutes, and I was aided by the fact that Japanese borrows many technical and scientific terms from English. It's not really fair that English is the de facto international language, but I'm really, really glad it is.

After landing at the airport, we crammed our equipment and ourselves into a taxi-van, and returned to the little apartment we stayed in before leaving for Uzon. There's a washing machine there, so we ran as many loads of laundry as possible.

Back at the apartment in Petropavlovsk, we tried (and mostly failed) to get the smell of hydrogen sulphide off of us.

Then next day, we piled into another taxi-van and rode to the Flamingo Hotel, where the workshop will start tomorrow.

Update : Below is a summary of my favorite talks at the workshop that I wrote on the flight back to California.

There have been a number of really exciting talks here at the workshop, and I can't summarize all of them. So, here are a few talks that have kept me thinking.

Sergey Varfolomeev : The youngest natural oil on Earth

Carbon-14 dating indicates that Uzon contains petroleum-like oil that is less than 50 years old. Very similar compounds were obtained by low-temperature pyrolysis of cyanobacteria and microalgae isolated in the vicinity to the hydrocarbon sample sites.

Albert Colman : Chemistry and geobiology of life in hot carbon monoxide

One of the key events in the establishment of our existing ecology was the development of an oxygen rich atmosphere. This process occurred in several stages, and one of the key stages marked the end of the Archean eon. Archean ecosystems are thought to have included oxygen-producing organisms, but during the Archean eon there were enough free reducing compounds in the atmosphere, ocean and soil to consume all the oxygen they produced. The Archean eon ended when these chemical oxygen sinks were finally overwhelmed, and oxygen started to build up in the atmosphere. In order to understand how and why we have an oxygen-rich atmosphere, it is important to understand how the Earth's atmosphere worked during this period.

Albert and his group are studying the role of carbon monoxide in the Archean atmosphere. There are a variety of organisms that exist today (particularly in volcanic environments like Uzon) that grow on carbon monoxide, and for this reason, the biosphere is usually treated as a sink for carbon monoxide. However, there are also organisms that produce carbon monoxide as a waste product, and so the coupling of atmospheric carbon monoxide to the biosphere in Archean climate models needs to treat the biosphere as a source and a sink to properly capture the dynamics.

I find all of this to be fascinating. It's very important that we get a handle on this stuff; mankind has been conducing a huge, uncontrolled experiment with the Earth's atmosphere since around 1820. Learning about other such "experiments" in Earth's history (in Archean, by microbes rather than humans) is pretty important.

Evengy Nikolaev : Mass spectrometry

I had no idea there were so many kinds of mass spectrometers! I guess that's what I get for my background in theoretical physics. My inclination is to write

and call it a day. Mass spectrometry, to me at least, has always meant this :

Schematic of a basic mass spectrometer.

If you stick some ions in a constant magnetic field, their orbital frequencies will depend only on their mass and charge. So, you just aim your beam of ions through a magnet, and all your ions will segregate out like colors in a rainbow. Done. High school physics, right? Wrong!

Evengy's talk was like looking up a recipe for pancakes and discovering that there are breakfast, lunch, tea, and dinner pancakes; that they can be made from fifty different grains and pulses; and that there are pancake recipes suitable for every occasion ranging from a quick bite while driving to work in the morning to the main course of a king's coronation. That's a lot of mass spectrometry!

Juergen Wiegel : Interspecies heterogeneity and biogeography of Thermoanaerobacter uzonensis

I'm really interested in biogeography generally, and so I was waiting for this talk. The Baas-Becking hypothesis that "everything is everywhere, but the environment selects" has been one of the key ideas in microbiology. As gene sequencing has gotten more powerful, it has been possible to test this hypothesis with increasing confidence. Juergen presented some findings that take another step toward disproving hypothesis and establishing the importance of locality in evolution.

Basically, his group at the University of Georgia obtained 16s small subunit rRNA sequences from Thermoanaerobacter uzonensis isolates collected in different spots in Kamchatka. The collection sites ranged from a few meters apart to about 300 kilometers. It was found that divergence among the sequences correlated positively with geographic distance.

The environment does indeed select, but the Baas-Becking hypothesis only holds for fuzzy definitions of "everything" and "everywhere."

Anna Perevalova : Novel thermophilic archaea of order Fervidicoccales - diversity, distribution and metabolism

I had been bugging Anna during the field expedition to tell me more about Fervidococcus fontis, which she discovered. F. fontis grows between 55C and 85C, which is an unusually wide range. The genome has recently been sequenced, and she presented some of the preliminary results from the annotation.

I still find it mysterious how one sets out to find new species (in this case, a new genus). Anna works in Elizaveta Bonch-Osmolovskaya's lab at the Winogradsky Institute of Microbiology, where they used a technique I'd never heard of called Denaturing Gradient Gel Electrophoresis and a myriad of selective media cultures to coax this organism out of the woodwork. Pretty hard-core, if you ask me.

Sergey Gavrilov : Electrochemical potential and microbial community composition of bioelectrochemical systems employed in situ in hotsprings of Uzon Caldera

This is a pretty awesome idea. Microbial fuel cells exploit the fact that cellular metabolism requires the transport of electrons outside the cell to deposit on acceptor substances, and couple this process to an electrical circuit. Sergey discussed a modification of this idea called sediment microbial fuel cell; instead of growing his microbes in the lab, he carried his cathode and anode out into the field and stuck them into a sedimentary formation in the environment.

The awesome part of this study is that Sergey isn't just looking for high power output. He's using the fuel cell to select for current-producing organisms from a diverse community, and then studying those organisms. After letting his circuits run for ten days, he found biofilms growing on the electrodes that had very different community structure from the controls (same setup, but with an open circuit). It's basically an enrichment culture that enriches for microbes that like to make electricity.

David Bernick : New discoveries in the hyperthermophilic genus Pyrobaculum enabled by deep RNA and genome sequencing

It's interesting to see how much fine structure can be found when an organism is sequenced deeply enough to capture it. David's team is using massive Illumina sequencing to do something like the Hubble Deep Field for an archaeal genome and its small RNA. They also sequenced a new member of the genus, P. oguniense, and discovered therein a new virus and a number of cool virus-related genomic features in the host.

Frank Robb : Lessons learned from sequencing carboxydotrophic bacteria and the race to discover hyperthermophilic cellulases

Frank was the only person at the workshop to give two talks, and they were both pretty cool. The first talk summarized results presented in a paper amusingly titled ‘That which does not kill us only makes us stronger’: the role of carbon monoxide in thermophilic microbial consortia. This work covered a lot of ground, including some compelling evidence for archaea-to-bacteria lateral gene transfer of chaparonins, as well as a results showing rapid accumulation of frameshift mutations when C. hydrogenoformans is grown under syngas, allowing it to grow rapidly by fixing carbon monoxide from syngas. Syngas is also known as wood gas, a simple intermediate for converting a variety of biomass feedstocks into usable fuel. If one wanted to obtain pure hydrogen gas from syngas, an organism that can eat the carbon monoxide could be handy.

The second talk presented some really interesting work in which a consortium of one cultured and two novel archaea was isolated from a thermal spring in Nevada that was able to grow on filter paper at 90C. A cellulase capable of degrading crystalline cellulose into reducing sugars at 100C was isolated, and the genes responsible were cloned and expressed in E. coli.

This is also pretty exciting for the biofuels people. One of the problems with moderate-temperature cellulases is that it's impossible to keep a huge vat of wet, ground up plants sterile. As soon as cellulase activity starts putting simple sugars into solution, something will start to eat the sugars. However, if you conduct the process at pasteurization temperatures, then you just have to worry about contamination by hyperthermophiles. So, as long as you keep people like Frank Robb and Karl Stetter from dropping their used lab equipment into your processing vat, you should get a nice yield of sugars from the cellulose without having it all eaten up by pesky yeasts and suchlike.

This post is for August 11th, 2010

Sarah and Albert managed to finish the DNA extractions last night, much to everyone's relief. Early that morning, we were visited by another bear, which we caught on video this time.

As we started packing up our gear, we got word that the helicopter would be arriving to pick us up around mid-morning, rather than mid afternoon as we had expected. A furious scramble to pack everything up began, and Frank set off into the field alone to retrieve enrichment cultures that we hadn't collected yesterday.

I tried my best to stay out of the way, since I had already mostly packed up the day before (no great accomplishment -- I didn't bring much in the first place). All of my samples were already safely stowed with Albert's. In retrospect, I should have gone with Frank to help him, but he vanished almost the instant we heard the thwak-thwak of the helicopter coming over the caldera wall.

Bo He carrying equipment to the helicopter flight from Uzon.

Just as we finished packing the helicopter, Frank came charging over the ridge from Central Thermal Field carrying all the enrichment samples he could find.

Packing the helicopter.

Amazingly, we only left a few things behind. A small digital camera, my toothbrush, and a few enrichment samples that sank too deep into one of the springs. Later on, Albert was able to retrieve the samples and the camera by joining the workshop excursion. He did not retrieve my toothbrush.

Karymsky volcano erupted again on our flight back. A most majestic farewell.

On our flight back, Karymsky volcano erupted again, again just as we flew past. It was a majestic farewell indeed.

I really, really regretted having to leave Uzon. It was a privilege and an honor to have gone, and to have gone with such company. In the next weeks and months I will have to work very hard; perhaps a big enough scientific payoff might justify a return trip. I certainly hope so!

This post is for August 11th, 2010

Russia is working hard to reign in the chaos that followed the end of the Soviet Union, and Kronotsky National Biosphere Park is no exception. Restrictions on hunting and fishing that were once widely ignored or impossible to implement are now being enforced. The rules are not exactly settled, but it is clear that the park administration is serious about protecting the wild state of the preserve. This is a Very Good Thing.

In 2005, Frank joined an expedition to Uzon led by Juergen Wiegel; this was before the research station was built, and so they flew in several large tents packed in crates. The crates could be unfolded to form a platform for the tents. When they broke camp, they left the crates behind. If the park administration is going to be serious about protecting the natural state of the caldera, Frank and Albert thought it would be a good idea to do our part too. So, we spent the morning breaking down the crates at the 2004 camp. We then hauled the disassembled crates to the research station (new since 2004), and arranged them in neat stacks. The rangers will find some use for the wood now that in easy reach, I'm sure.

When we arrived, the crates from the old camp were piled up in the middle of the camp. I'm not sure exactly how long the crates were splayed over the ground at the old site (they were designed to form a platform for the tents) before they were piled up there, but I find it interesting that the footprint of the old camp is still clearly visible. The plants are still in the process of recolonizing the space. There can be no more explicit evidence that Uzon's ecology is indeed fragile. The lush meadows I wrote about yesterday would probably take decades or centuries to form if they had to start over from scratch. I'm sorry I don't have any pictures; one cannot be both a good photographer and diligent manual labor at the same time.

Alex thinks he has pulled a fast one on me. Anna is not amused by any of this. Not even Frank's hat.

After lunch, Frank and I set out together to collect some samples from Burlyaschy and K4 Well.

Collecting a sample from Burlyaschy (Boiling Spring). It's about 90C where my feet are, and it's deeper than my ankles. It's a good thing I'm wearing thigh waders and three pairs of socks!

While Frank was working on his own samples, I waded a few meters into Burlyaschy Spring to fill a liter bottle with water. The water is about 90C there, and boiling vigorously only three or four meters beyond. I was wearing three layers of insulated gloves, and three pairs of socks under my waders, but the heat was almost unbearable. You really don't want to fall down in this thing!

Filtering a liter of water from Burlyaschy with a Sterivex filter and a 60ml syringe. The bottle was almost too hot to handle, even with insulated gloves. If there's anything alive in the planktonic community, it's definitely a hyperthermophile!

After (carefully) returning to what passes for dry land in the thermal field, I decanted the liter bottle into a 60ml syringe with a LuerLok fitting, and attached a Sterivex-HV 0.45 micron filter. I then forced the water through the filter, which started to block up after about 600ml. The last 300ml went through really, really slowly and with a lot of sweat and cursing. It took a 20 repetitions to finish off the bottle.

Decanting spring water collected from K4 Well into a 60ml syringe, to be forced through a Sterivex filter.

After that, we walked over to K4 Well to collect Frank's slides. Frank is planning to use them for electron microscopy, so he had to fix them before storing them, which took a long time. This gave me time to process two liters of water and steam spewing from the rupture on the K4 wellhead and shove them through two more Sterivex filters.

We walked back to the station, and I fixed my filters in ethanol and D-PBS buffer.

This was to be our last full day in Uzon, so I packed most of my things before going to bed. Albert and Sarah stayed up all night finishing the DNA extractions.

This post is for August 10th, 2010

The weather is absolutely beautiful today; sunny with a few puffy, fast-moving clouds, about 60F with gusts of cool wind.

After breakfast, Frank, Alex, Anna and I hiked to Orange Field. Most of the hike was over open country without trails; we had the GPS coordinates, but no route. We passed through a few stands of birch and pine. The prospect of encountering a bear in enclosed areas makes entering these clumps of trees an unattractive course of action, one could say. Encountering the occasional bear seems to be unavoidable in Uzon, so we stuck to open country and burned up some calories circling around the trees. The August sun could have made this torture back in Davis, but at almost 55 degrees north with patches of snow lurking in the shady spots of the caldera, it wasn't so bad.

A meadow abutting the caldera wall on the hike to Orange Field springs.

It's astonishing how much plant diversity there is here. What looks like fields from a distance are really dense mixtures of dozens (hundreds?) of species of plant, crowded together in a tangled riot. When I put my face near the ground, it looks a tropical rain forest, only ten inches high.

We are here to study microbes, but it's very difficult not to wonder about this hardy community of plants. How do they survive the winter? Why does one kind of plant cluster in one place and not another? For what do they compete, and how do they do it? Do any of them cooperate? How do the seeds disperse? What pollinates the flowers?

I am puzzled I that there seem to be so few pollinators in Uzon. I found a few insects that looked like bees, but I'm not familiar enough with entomology to rule out the possibility that they could be bee-like flies, or possibly wasps. In any event, there were not very many of them. The only insect I found visiting a flower today is a thing that looked like an earwig, but it was probably there because it took a wrong turn somewhere. The millions of flowers in Uzon seem to go mostly unvisited.

Panorama from the ridge overlooking Orange Field springs.

Anya was here in Uzon in 2005, except a few weeks later in the year. In her pictures from that expedition, the whole caldera looks like it's been set afire as the hardwood brush gets ready to drop its leaves.

The other thing that puzzles me was how few birds there are. The caldera is bursting with blueberries and mosquitoes, and yet I've seen only one swallow and heard not a single songbird. Meadows in California with a tenth the productivity (i.e., insects, fruit and seeds) are usually crammed with swallows, starlings (introduced, of course), jays, finches and songbirds. In Uzon, there are only a few white, long-winged birds with V-shaped tails that fly low and fast above the streams. They look a bit like a quarter-scale seagull, but re-engineered for speed and extreme distance-flying. They have bodies built like marathon runners, so I suppose Uzon must be a quick stop on a long journey for them. I've only seen two or three of these on a given day so far.

The lack of birds, especially songbirds, and the lack of pollinators are probably related. The winter in Kamchatka is too harsh for most birds to overwinter, so most birds found here would be migratory. Insects are ideal diet for a long-distance migratory birds, and they need lots of them to build up enough fat reserves for their world-crossing journeys. Maybe our timing is off, and we've just missed the migratory birds, or maybe they will arrive later when the blueberries are riper, or when their favorite species of insect reaches its crescendo. Or, perhaps the birds that used to come here are gone, their migratory route destroyed by a parking lot in a faraway place.

A carnivorous plant waits for the arrival of small, unlucky insects on the bank of Orange Field springs.

Karnosky National Biosphere Preserve is for Russia what Yellowstone, Yosemite and the Grand Canyon are to America. It is perhaps the single most beloved natural site in this vast country, and the people who have studied and explored it are heroes in Russia (they should be heroes worldwide). Tatiana Ustinova, who discovered the Valley of the Geysers, could be the John Muir of Russia. I'm sure that someone has studied the songbirds in Uzon, or lack thereof, just as the songbirds of Yosemite have been meticulously studied. However, Ustinova only discovered the Valley of the Geysers in 1941, whereas Yosemite and Hetch Hetchy were well known to the world more than a hundred years prior.

The problem, I think, is the disconnect of the scientific literature among countries. Before I left for Kamchatka, I looked for books like John Muir Laws' beautifully illustrated field guide to the plants, fungi and animals of the Sierras, but I could not find anything. My questions have probably been asked and answered, but only in Russian, and probably only in journals far from the beaten path.

I hope that this will change.

Debris left over from Karpov's old house (I think), which was heated by geothermal power. I'm holding the auger used to drill the well.

At Orange Field, Alex and Anna collected several samples for their colleagues at the Russian Academy of Science. We spent about two hours roaming around and waiving Anna's GPS at the sky, trying to pinpoint which spring was which. This is an uncertain proposition in a place like Uzon, which is subject to the vicissitudes snow, snowmelt erosion, the dynamic processes of volcanism, and curious bears that like to dig holes.

Team Russia, for the win!

When we got back, we ran the generator for a while so Sarah could do her DNA extractions. I used the opportunity to work on metagenomic analysis for Arkashin and Zavarzin a bit, organize photos, assemble some panoramas, and edit the last couple of days of blog entries. I also got in some really excellent procrastination on finishing my talk. I squished one hundred and sixteen mosquitoes and three biting black flies.

Anna made Borscht for us again, and it was, if anything, even more delicious than her previous Borscht. Same ingredients, same pot, same stove, same sour cream. I am puzzled, but that seems to be my lot in life.

This post is for August 9th, 2010

It was very cold, wet and windy this morning, and I had a rough time getting started. A double shot of espresso helped, but it took a brisk hike to Burlyaschy to collect my first samples of the expedition to actually wake up.

Collecting sediment samples from the outflow of Burlyaschy (Boiling Spring). This is my first field sample since starting grad school. Neat!

Frank and I thought it might be interesting to try to sample from the center of the spring near the heat source, so we tied a 50ml tube and a rock to a rope and dragged it across the bottom of the pool a few times. It didn't work, unfortunately, so we're going to try using a long tube and a hand pump tomorrow.

Our improvised sampling gadget. It didn't work unfortunately. The bottom of Burlyaschy evidently doesn't have any sediment.

Our efforts were interrupted by a bear, a real one this time, that wandered out from behind a hummock about fifty feet away. We dropped what we were doing and circled to the bank of Burlyaschy opposite the bear. In principle, we could sidle in one direction or the other to keep the spring between us and the bear. A bear can easily outrun a human in a straight line, but on a turn, particularly in boiling mud, we have a better chance. If it tried to cross the pool, we would quickly end up with a few thousand gallons of bear-and-microbe soup.

A bear interrupted our work at Burlyaschy.

Happily, the bear showed little interest in us, and wandered off. It doesn't make for great photography, but I've decided that the preferred view of a bear is the posterior as it walks away.

Fortunately, he showed very little interest in us.

We returned to the station without incident and had some lunch. Alex and Anna went off to collect some samples for their colleagues in Moscow, while Frank and Bo packed up his computer, a huge APC power supply, and his scanning voltometry apparatus lumbered off to Red White and Green. Right now, Sarah and I are upstairs with the Russian expedition to use the lab bench for DNA extractions.

Sarah working on DNA extractions.

Later on, the weather cleared up to reveal an extrodinary afternoon. I was persuaded to go to so-called Bath Pool with the Russians. I'm not sure if I am any cleaner as a result, but the experience was... interesting.

Anna and Alex returning from Central Thermal Field.

This post is for August 8th, 2010.

Anna at Central Thermal Field. As the ranking Russian in our group, she is our chief scientist for this field expedition.

We awoke to heavy fog and rain this morning, and it was very cold. I went with Alex, Anna and Frank on a long hike to a group of petroleum-bearing springs. Along the way, we stopped at Boiling Spring (Burlyaschy in Russian), which really is boiling. We measured 96C near the edge, and it's about the size of a backyard swimming pool!

Boiling Spring.

Frank suggested on the walk back a few hours later that Boiling Spring might be an interesting metagenomic target; it's surrounded by extremely acidic formations -- we measured pH of 0.8 at one of them -- and yet Boiling Spring itself is at pH 7. It's likely to be relatively isolated from the surrounding environments. Because Uzon is much nearer to sea level than Yellowstone (650 meters, according to my phone), it's actually possible to find water at nearly 100C at the surface here. This suggests that it could be a good place to look for high temperature chemoautotrophs. Boiling Spring is also nearby an area known to be rich in petroleum sediments, so there could be high-temperature hydrocarbon utilizers too.

A petroileum-rich spring.

We then proceeded on to what Frank calls "the oil fields," where Alex, Frank and Anna took some more samples. There is a talk scheduled later at the Thermophiles Workshop by S.D. Varfolomeev called "The youngest oil on earth (Uzon, Kamchatka)," presenting evidence that there is petroleum at Uzon that is less than 50 years old!

Given the name "Oil Fields," I was expecting it to resemble La Brea Tar Pits in Los Angeles. I spent a lot of time at the Page Museum when I was young, so many of my formative experiences involved mammoths and smiladons and lakes of bubbling tar. I caught a few whiffs of that smell, but it was mostly the usual hotspring rotten-eggs.

We passed the ranger station on the way back, around three o'clock in the afternoon.

Around three o'clock, the rain finally let up enough for me to crawl out of my cheap yellow poncho. We ate a little bread and cheese we brought with us (and a chocolate bar, of course), and started hiking back toward the station. Along the way, we stopped to check on Frank's slides at K4 Well and then back to Red White and Green. Frank and Alex left some enrichment cultures to incubate at Red White and Green and another nearby spring with a very high temperature.

Alex and Anna wanted to keep working in the area, and so Frank and I hiked back to the station.

There was a tetrahedron of milk we opened for breakfast coffee, so I used it up to make an onion, garlic and dill fritatta for the two of us, and we talked some more about what might be living in the outflow from Boiling spring.

Alex and Anna eventually got back, and Anna made some scrambled eggs, and the ranger (Evgenij) joined us for lunch.

We spent the afternoon struggling to charge UPS for Bo's scanning voltometry gear. Balky generators and rain make a poor mix.

While that was going on, Bo, Albert and Sarah went to Burlyaschy (Boiling Spring). Albert spotted a mother bear with a cub nearby and moving toward them, so he readied one of our flare torches to scare them away. Before igniting the torch, Albert tried shouting a bit, and took a few steps toward the bears. The bears suddenly revealed themselves to be bushes in the fog, rattling in the wind.

This post is for August 7th, 2010.

It was cold and cloudy today, which is actually a blessing. We have to walk around in thigh-high rubber boots and stand around boiling pots of sulfurous water, and the mosquitoes are murderous.

I think I've got the hang of making a decent espresso in the field, at least with this incredibly delicious water. I found an adapter in an outdoor store in Petropavlovsk that mates the valve socket for my camping stove to cheap cans of cooking gas available practically everywhere. Unfortunately, the cans are completely unstable with any sort of pot or pan sitting on the stove, so I braced the can with some bricks from an old cook fire.

Some espresso on a cold, wet morning.

I packed light, which means that tomorrow I'll be on my last pair of clean pants. Tomorrow I will have to do laundry.

This morning we visited Arkashin spring, which is the other sampling site for the metagenomic data I've been analyzing. It's loaded with realgar (arsenic sulphide), and so it's expected to be full of species that are resistant to the various forms of arsenic, arsenide, arsenate, and possibly arsenic respiring organisms. Alex and Sarah took some samples of the sediment.

Arkashin Spring, one of my metagenomic targets.

We also spent a lot of time looking at a nearby site called K4 well, which is the remains of an old exploratory well drilled sixteen meters into Central Thermal Field. As you can see, the steel has been pretty much destroyed by corrosive hydrogen sulphide gas. The interesting thing about K4 is that the outflow starts out as a mix of steam and boiling water at about 100C, and cools off to about 40C over a space of about three meters. As a result, the organisms that live in each temperature band between 100C and 40C are organized into stripes following the contours of the isotherms.

K4 Well, a possible site for investigating spacial organization of microbes.

Frank and Albert inserted some microscope slides into the flow (if you leave them there for a while, the microbial mat will incorporate the slide which you can then remove to study). I'm very interested in studying this sort of spacial organization, and so Frank gave me a slide to insert transecting three of these bands. Glass is a good conductor of heat, and so I'm not very confident that it will work.

On the way back to the station, we came across a very interesting pool that Albert thought would be a perfect for Bo to try out his electrochemical instruments. Bo didn't come with us for the morning trip because he was still polishing, plating and testing the electrodes for his setup. There obviously isn't any cell phone reception out here in Uzon, but my little Android phone still makes a really great field GPS. I marked the coordinates for the pool as "Red White and Green" (sadly, there was no blue).

For lunch, we had buckwheat with tomato sauce, green peas and tofu (the carnivores added their canned mystery meat). It tasted great, but the buckwheat didn't agree with me at all. I took some anti-acid tablets, and then passed out for an hour. I woke up a bit overwhelmed by the taste of buckwheat and hydrogen sulfide (for some reason, whenever I smell hydrogen sulphide, I seem to keep smelling and tasting it for a long time afterward). Bo still had to work on his electrodes for a while longer, and so I sat around with a cup of tea and waited for the afternoon trip.

Bo packed up his electrodes, data acquisition system, laptop and portable power supply into a huge backpack/duffel, and I guided everyone back to Red White and Green. The Android phone worked great as a field GPS.

Bo getting his first scanning voltammetry data.

This is some of Bo's data from the field. The peaks and dips represent changes in current detected passing from one electrode to the other (in the presence of a reference) as the voltage was swept from zero to -2V and back. The cathodes are made of gold wire plated with mercury film (sort of like old-fashioned dental fillings), and the anode is elemental platinum. Scanning voltammetry is also known as cyclic voltammetry; the trace on the bottom is the return signal when the voltage swept back to zero. In the order they appear in the scan, Bo's first guess as to the identity of each dissolved compound are as following; thiosulphate, hydrogen sulphide, iron sulphide, hydrogen peroxide, iron (or maybe manganese) (II)+, and on the return scan, acid volatile sulphide (AVS).

The software Bo uses to drive the probes is a little crusty, so I decided to help him out with a little Python/Matplotlib awesomeness.

One of Bo's voltammetry scans; the annotations are based on Bo and Albert's experience with the technique and their best judgment while in the field; this is not their "final" conclusion about the water chemistry. As the science goes, think of this as somewhere between raw ingredients and the finished product, like bowl of cake batter.

When we got back, I cooked dinner; pasta with corn, onions Lithuanian-style cheese and some Georgian spice mix. The carnivores added a mysterious can of meat with a picture of a cow on it.

I went outside this evening to send a twitter update with the Iridium phone, and I thought I was safe from the swarming mosquitoes in my bug suit and thick socks. When I say "swarm," I really mean it. As I stood on the boardwalk, it sounded exactly like a 2010 World Cup game, complete with vuvuzelas. I miscalculated badly, and I got twenty-nine bites on my feet -- through my hiking socks -- in the three minutes I was standing still. I didn't notice until my feet started burning, like the way your mouth burns when you eat a chili pepper. I ran inside and dunked my feet in a bucket of near-freezing stream water until the burning stopped. Then soap and more freezing water, topical astringent, and three antihistamine pills. I have a little bit of swelling, but hopefully not enough to stop me from getting out tomorrow.

To my delight, the entomologist staying here decided this was a great evening to take some samples of her own. She fired up the generator and put a huge flood light on the upstairs portico. Then she used sweep nets to capture bucketloads of mosquitoes, which she preserved in formaldehyde (or something of the sort). It warmed my heart to see that.

Before heading to bed, I figured out how to bathe with three liters of water. The pump is broken, and so if you want water, you have to lug it from the stream, and if you want hot water, you have to use the tea kettle.

The day began with a breakfast of rehydrated oatmeal, instant coffee (my espresso had not yet been located amongst the luggage), and yogurt. Just as we were drifting off to unpack and organize, a juvenile bear showed up on our doorstep, and snuffled around a bit near our outhouse and the little bridge over the stream.

A bear visiting the research station on our first day in Uzon. That boardwalk is the path to our outhouse; this was shot with a short lens from the kitchen porch.

This is why we carry signal flares to the toilet, and only go in groups.

After watching the bear wander off to forage for blueberries (which are everywhere), I sat down on the little bridge and made myself a cup of espresso from the stream water. The Russian team upstairs tells me that when they've tested it, it came back almost as clean as the molecular-grade water they brought with them. It was the best damn espresso I've ever had.

Espresso.

Preparations for sampling and measurements proceeded in fits and starts through the morning as Albert, Frank and Anna hammered out a plan for each day of the expedition. While that was going on, Bo, Sarah and I continued unpacking and organizing the gear.

I attempted to shave at the stream, but this did not go as well as the espresso. Hot water is important for shaving, and I didn't make enough of it. The stream is only seven degrees Celsius, which I discovered is utterly unsuitable for shaving.

Shaving did not go so well.

Around ten o'clock, the ranger took us on a tour of the thermal fields. Frank and Albert have been here several times of course, but the fields are never quite the same year-to-year. In 2008, for example, a geyser popped up near the ranger station; Uzon is not known to have geysers.

Zavarzin, one of my metagenomic targets. Alex is measuring the temperature, and we worked around some enrichment cultures set up by another research team.

We stopped by Zavarzin Spring along the way, which was particularly interesting for me. For the last few months, I've been analyzing some metagenomic data taken from Zavarzin a few years ago as part of the Tree of Life project. Until today, Zavarzin was just a FASTA file containing about ten thousand Sanger reads, like so :

>ZAVAK94TR 6000 12000 9000 21 953 GTAGCTGTAAGGGCGGGGAGGGCTCACCTGGTCCCGGCCTTCGACGGCGGCCCCAATCCG GCCAGCGCCCAGGCCCTCACCGAAGTCGAAGCCTACGCCTTTTCCTGTTCCGATTTCCGG AAACTGATAGGGGAGTTCCCCCGGATTGCCGGCAATATCCTGGCCGATTTTGCCGCCAAA TTGCGCCTGCTGGTAGGGCTGGTGGAGGACCTCTCCTTCCGTACGGTGGAGGCGCGTCTG GCCCGTTTCCTCCTGAGCCGGGATGTGGCCGTGCCCGGCCGGCGCTGGACCCAGGAGGAG ATGGCCGCCCACCTGGGCACGGTGCGCGAGGTGGTCGGCCGAGTGCTTCGGGCCTGGCGT GAGGAGGGTCTGATTCGCCAGGAACGCGGCCGCATCGTCATCCTGGACCGGGCCGCGCTG GAGAAGAAGGCTCAAATCTGACATCATTCGTGCCAGGACGAGTTATGCAAAGATGTCAGG AAAAAGGACTTTTTGACAAAGAGAGGGGAATATGCTACATTGTCAGCCCCGGAGGGCCGG CCCGCATGGACCAACCGCATCCGGGTGACCCGAAAGGCAGAAACGTTCGGGCAGGCTGAT GATGGACACGTTCCGCGCCATCCGTCGGGTCCTCTGGATCACGATGGGGCTCAACCTTCT GGCTATGGCGGCCAAACTGGGCGTGGGCTACCTCACCGGCTCCCTCAGCCTGGTCGCCGA CGGCTTCGATTCGGCCTTTGACGGTGCCTCCAACGTGGTGGGGCTGGTGGGGATTTATCT GGCCGCCCGACCGGCCGACGAAGGCCACCCCTACGGCCACCGCAAGGCCGAAACCCTCAC CGCCCTGGGCGTCTCCGCCCTCCTCTTCCTGACGACCTGGGAACTGGTGAAGAGCGCGGT CGAGCGCCTGCGCGACCCGACTCGGATACAGGCCGAGGTCACGGTCTGGAGTTTCGGGGC CCTCGTCCTCAGCATCCTGGTGCACGCGACCGTGGTCTGGTACGAGATGCGGGAGGGCCG GCGGTTGAGGAGCGATTTCCTGGTGGCCGATGCCCAGCACAC

After so much time working on this data, it was pretty exciting to see the actual site.

I came back to the research station with Albert and Bo, and I fixed some lunch for everyone (apples and pears with Nutella, cheese and black bread, olives, some cucumbers sliced with lemon and dill, and the ubiquitous Russian sausage for the meat eaters).

After lunch, everyone except Bo went back to Zavarzin (Bo stayed at the station to work on the electrodes for his instrument). Albert and Sarah took measurements and tried out some home-made core samplers, and Anna and Alex started some enrichment cultures. This was a preliminary trip, so I mostly just tried to stay out of the way. I got some nice photographs of the rather extraordinary microbial mats growing in the smaller springs nearby.

I mentioned in a previous post that volcanic liquids are very diverse; this is the reason it's worth traveling all the way to Kamchatka. Here is a nice example of what I was talking about. These are three springs within about four feet of each other. You can see just by looking at them that they are different. The colors range from in clear to white to gray, indicating different redox states (probably of sulfur); the temperature ranges from 91C, to 86C to 81C, and the pH from 7 to 5.6 to 6.1.

Three adjacent yet very different springs.

That might not sound particularly dramatic, but recall that when you catch a fever, the shift from 37 degrees to 39 degrees is enough to halt the growth of a wide array of organisms. This is why fever is a response to infection. Microbes often adapt to very particular circumstances, and so a change of a few degrees can shift the ecology dramatically, or replace it altogether. As environments, these three springs are as different from each other as the inside of your mouth and the eyelid of a duck.

We finished up with our poking around at Zavarzin, and came home for a dinner of Borscht prepared by Anna. It was delicious. After dinner, we started setting up our lab space upstairs for DNA extractions. I managed to trip the breaker on the generator several times trying to charge up the UPSs.

My apologies for getting behind on posting my updates from Uzon. After we returned from Uzon, we rested for a day, and then crammed ourselves and our equipment into a van and went to Peratunka for the Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles international workshop, where I was scheduled to give a 20 minute talk.

The speaking docket got shuffled around a lot, and I ended up having to give my talk much earlier than planned. I suppose this is the inevitable downside of procrastination. While I was scrambling to finish it, I didn't have much time for blog updates!

I survived the talk. There were lots and lots of excellent questions, and I have a lot to think about now. Anyway, back to the updates from Uzon.

We were picked up by a mini-bus taxi from our apartment in Petropavlovsk, only to have to turn around to retrieve a forgotten jacket whose owner shall remain nameless. From there, we drove to Kronotsky Nature Preserve, and met up with a bunch of other people including Shpilenok, the director of the preserve, a Russian TV station crew, and some photographers. Also aboard was a group of people that included the granddaughters of Tatiana Ustinova, the woman who discovered the Valley of the Geysers with Anisifor Krupenin in 1941.

The discovery of the valley is an adventure all unto itself -- beginning with a dogsled trip that got off track and ending up with the discovery of first hydrothermal site in Russia. Tatiana, who eventually settled in Vancouver, passed away recently. Her family was aboard our helicopter on a visit in her memory to Geyser Valley. Her valley, one could say.

Frank spent much of our time in Petropavlovsk regaling us with stories of helicopters left over from Russia's war in Afghanistan and held together with bits of string. If our helicopter was that old, it has been lovingly maintained.

Our ride to Uzon touching down at the airfield.

I was expecting the ride itself to be exciting, but there is none of the rush and acceleration of an airplane takeoff; when a helicopter takes off, it gets very, very loud, and rises with all the grace and charm of a freight elevator. The excitement came entirely from the view out the portal, which we could open. Kronotsky Nature Preserve is spectacularly beautiful from any angle; as interesting as it was to see it from the air, I kept wishing we would land so I could get out and have a look around.

The view from the helicopter portal as we entered Kronotsky Nature Preserve.

I lost track of how many volcanoes we passed. The most exciting was Karimsky, which happened to erupt just as I snapped a picture of it!

Karymsky Volcano erupting as we fly nearby.

Actually, I didn't take this picture. There was a photographer sitting next to me using the same portal, and I had asked him to snap a few shots of Karimsky -- which was not erupting at the time -- because he had a better angle from were he was sitting. He snapped one shot of the volcano and gasped, and then dropped my camera in his lap and grabbed his own.

Karymsky Volcano erupting as we fly nearby.

Eruption of Karymsky Volcano continues as we fly over an inland delta.

We touched down in Uzon Caldera a few minutes later, and immediately ran into some confusion over accommodations. There are two buildings in Uzon Caldera; a ranger station, and the research station. The structures are each about the size of a modest single family home. There was already a team from Winigradsky Institute staying at the research station (the director, actually), as well as the ranger and an entomologist. Meanwhile, the ranger station is being renovated, and the work crew is staying there.

Our ride continuing on to Geyser Vally. The family of Tatiana Ustinova were aboard.

The helicopter crew had been told that we would be staying at the ranger station for some reason, and so the earlier flight had delivered all of our food and lab equipment to the landing pad nearest the ranger station. The ranger station is about a kilometer away from the research station, and so we had to schlep all thirteen boxes of lab equipment and four heavy boxes of food.

Shifting our food and lab equipment from the ranger station to the research station. It was a long and exhausting job.

Once installed at the research station, Sarah, Bo and I organized our gear and luggage, and Frank and Albert -- dead tired, like the rest of us -- went upstairs bearing gifts to make friends with the other research team.

We rehydrated some freeze-dried pasta primavera, to which Sara and I added tofu. I was too hungry to notice what everyone else ate, but I think sausage was involved. Then we passed out.

Panorama overlooking Orange Fields in Uzon Caldera

We just arrived back in Petropavlovsk after a week in the field. I was very sad to leave Uzon, and it was a privilege and an honor of the highest order to have spent those days there.

The expedition was, I think, a great success. We'll know for sure once we're back at our labs and can use more sophisticated methods to examine our samples. I am very confident, though.

It was a bit touch-and-go right at the end. Our high speed centrifuge crapped out last night, just as Sarah was in the middle of the last big run of DNA extractions. The Russian team brought their own centrifuge, but we couldn't run it on our generator. Much to our relief, Albert was able to magically get the thing working again by holding it at just the right angle. They worked through the night to finish processing the samples; I think Albert must have had his thumb wedged under the centrifuge for the entire run.

I'm sorry I wasn't able to send many Twitter updates toward the end of the expedition. Once I had identified my sampling targets, I suddenly had a lot less free time on my hands (and I didn't have much to begin with). Also, I'm sorry for updating in ALL CAPS. Iridium handsets are essentially 1993 technology. Composing text messages is extremely painful, and the battery only lasts long enough to compose two or three of them. This is a pain when you have to recharge on generator power, and the generator only cranks up for a few hours a night, and even then only to power lab equipment for DNA extractions. Hats off to my dad for relaying the messages!

Right now, I'm sitting in a friendly internet cafe in Petropavlovsk where they've let me use their wireless connection. When we arrived at our crowded little apartment, the hot water was broken, and thus no showers yet. A wide selection of interesting geologic samples are wedged under my fingernails, and I think I have wads of some sort of hardened liquid sulfur caked in my hair. The helicopter arrived ridiculously early, and we just barely get everything aboard. As a result, I'm still wearing my field clothes from yesterday, which are splattered with volcanic mud. I may actually be the worst-smelling person in Petropavlovsk. Perhaps it is fortunate that this internet cafe caters mainly to kids playing StarCraft.

I composed blog entries for each day we were in Uzon, and I'll be posting them as soon as I run them past the rest of the team. I also have almost two thousand photos to sort, tag and upload.

That said, I have a correction for one of my Twitter updates. I wrote :

YERTERDAY ALBERT & TEAM WERE CHASED AWAY FROM A SITE BY A BEAR THAT WAS ACTUALY A BUSH IN THE FOG.

Albert pointed out that they were interrupted for a few minutes, but not actually chased away. He stepped forward and shouted see if he bear (or bears) would go away, with his signal torch uncapped and ready. The bears were revealed to be bushes as the wind shifted and created a channel in the mist. It's funny, but given how foggy it was that day, it wasn't actually that surprising. We were at the same site the next day, and were surprised by an actual bear. It wandered pretty close to us before we could actually see it (the full story will come with the article for that day).

A bear interrupting important EisenLab work at Boiling Spring.

Update : Albert also says that I'm wrong about having to wedge his thumb under the centrifuge the whole time. It started working again after shaking it around in the air a bit, and placing it just so on the table. He only had his thumb wedged underneath it for a minute or two to check to see if it was overheating.

We're planning to return from Uzon on the 11th of August, so assuming we leave this evening, we'll be there for seven days. We have to plan for the possibility that we might get fogged in up there, so we might be stuck for a few extra days. Hopefully that won't happen, because we've got a workshop to prepare for once we get back. Also, I've picked up a bad habit from Jonathan, and I still have to write my talk for the 17th.

We had an exhausting day yesterday.

First, the cost of the helicopter has gone up since last time they made the trip, so Frank and Albert had to arrange to transfer the difference from America to Petropavlovsk. This turned out to be an agonizing process, and I'm not even sure of all the details. Albert came back to the apartment after the first day of working on it and passed out instantly. Suffice it to say that both of them have extremely patient and resourceful spouses, without whom we would now be stranded in town with no way to get to our research site.

There remains a great deal of confusion and uncertainty about the status of the generator (or generators?) at Uzon, and so we've had to prepare for the worst. I spent the day with Albert and Alex hunting down motor oil, spark plugs, and two-stroke oil (in case it's a two-stroke engine), and other small-engine stuff. Supposedly there is a new American-market Honda generator up there, a Soviet-era machine that can still be persuaded to work, and perhaps something else of unknown providence and status. We were also told that there was no generator at all, sending us scrambling all over town to buy a new generator, but that was evidently a misscommunication. Fortunately we got it straightened out before we actually started laying out Rubles for the first generator we could carry away!

In the summertime, the research station would be a truly ideal place for an off-grid solar array. One of the things I'm going to do while I'm there is to study the structure an write up a proposal for its owners to install one, if they should so desire.

After much looking around I found that, nobody sells regular fuel canisters for backpacking stoves in this part of Russia. However, they do sell adapters that let you plug them into butane refill canisters. The canisters are very cheap, but they are shaped like cans of hairspray; narrow and tall. Not a very stable platform for cooking! I'm going to set up my stove in a bucket, and pack dirt around the fuel canister to keep it stable and upright (and far from anything that might melt or burn). And yes, I'll only use it outside.

Demonstrating the use of mosquito protection gear for Bo -- you can tell I'm not really excited about mosquitoes

I was able to find a SIM card for my MyTouch 3G, which is awesome. Unfortunately, MTS doesn't know how to automatically configure Android phones for GPRS. At least, that's what I could understand from the girl at the MTS store. That conversation was conducted mostly through hand gestures and giggling, and was a testament to the power of technology-related acronyms to puncture language barriers. It's strange to say, "IP for DNS server?" and see the light of understanding spread across a person's face.

We bought more than 15,000 Rubles of food for the trip! Actually, that's pretty reasonable for seven people.

Last of all, there was the food. By the time we all got to the grocery at 7:00 in the evening, we were almost totally spent. Still, we had to shop for another two hours before we had everything we need (at least, I hope we have everything we need).

This morning a truck from the Institute arrived at the apartment to pick up our food and laboratory equipment. We're not totally sure if we will be riding with it to Uzon, or if it will go on a separate helicopter. So, we had to waterproof everything last night in case it had to spend the day (or evening) on the landing site in the rain. I am glad we had plenty of plastic bags and tape!

Our food and lab equipment getting picked up

With luck, we will catch our helicopter to Uzon this evening.

Professor Frank T. Robb, University of Maryland

Frank is the co-chair of the workshop, and is leading our expedition. Frank is a regular in Uzon Caldera, and has made several expedition to the site since 1995.

Frank has been studying thermophiles for around twenty years, including their physiology, genomes, proteins, and ecology.

Professor Albert Colman, University of Chicago

Albert is organizing the expedition this year, and has accompanied Frank (and others) to Uzon several times. Albert was Frank's graduate student back in the day.

Alex Merkel, Winogradsky Institute of Microbiology

Alex graduated from Moscow State University, and is now a Ph.D. candidate at the Winogradsky Institute of Microbiology in Moscow. He is studying the functional diversity of methanogenic genes and culturing methane producing microorganisms.

He is also secretly the lead singer from Coldplay.

Anna Perevalova, Moscow State University

Anna graduated from Moscow State University and obtained her Ph.D. from Winogradsky Institute of Microbiology in Moscow. She is now a postdoctoral researcher at Winogradsky. Her specialty is growing extremely difficult organisms, and she also works with Alex on methanogens.

Sarah Griffis, Caltech and University of Chicago

Sarah is a senior at Caltech, and has been working in Albert's lab in Chicago for the summer doing DNA extractions.

Bo He, University of Chicago

Bo is a graduate student in Albert's lab; he studies the electochemistry of cellular redox metabolism, particularly as it pertains to metal chemistry. He did his MS at Chapel Hill on the kinetics of iron III and hydrogen sulphide in sediment formation. It's nice to have someone with a physical sciences background along for the trip!

Russell Neches, University of California, Davis

And, of course, me.

Singlehandedly bringing PLoS to new frontiers!

I arrived safely in Petropavlovsk yesterday after a very long layover in Khabarovsk and an even longer layover in Vladivostok. Frank Robb and Alex Merkel met me at the gate, and we wobbled off with our driver to the Volcanology Institute to file my paperwork.

Beer! Where have you been all this time?

After dropping my stuff off at the apartment, Frank took everyone out for pizza. Airport and airline food in Russia leaves a bit to be desired, especially if you are vegetarian and don't speak Russian. Pretty much everything is covered in, stuffed with, or made entirely out of sausages.

I basically hadn't had anything to eat in 24 hours, so I was extremely glad to get my hands on the pizza (I ate almost two). The beer was also extremely welcome.

Fog, cursed fog.

Unfortunately, Petropavlovsk is fogged in with what everyone keeps caling a "cyclone," but I don't think the word is used in the same sense as I'm used to. It seems to be a huge fog bank with drizzle coming in from the ocean. The helicopters we will fly to Uzon Caldera are fly-by-sight, so we're grounded in Petropavlovsk until the weather clears.

For now, it's seven scientists crammed into a tiny one-bedroom Soviet era apartment with a dozen laptops, piles of camping gear, and two whole laboratories (one for geochemistry, one for recombinant DNA) stuffed into freight boxes. Time to go exploring...

The door to Petropavlovsk; due for a little maintenance

Anyone who's played Risk will probably remember Kamchatka as "That place you can attack Alaska from." Like most of the territories in Risk, Kamchatka of the Hasbro game doesn't exactly match its modern political boundaries :

However, the Risk territory does reflect the range of the Chukotko-Kamchatkan language family, which includes the language spoken by the Koryaks (Kamchatka's indigenous people) :

400,000 people live on the peninsula, and about 13,000 are Koryak (about 3%). For comparison, Alaska has about 686,000 people, of which roughly 100,000 (15%) are native peoples. In terms of population, the Koryaks' situation more closely resembles that of the Ainu of Hokkaido (also about 3% of the population, going by self-identification) than native Alaskans.

Kamchatka has volcanoes. Lots and lots of volcanoes. It's part of the Ring of Fire, with 160 volcanoes, 29 of which are active. The whole area is seismically active, and there was a decent-size quake off the coast just this Sunday.

Phil Plait at Bad Astronomy posted about an this awesome photo of two Kamchatkan volcanoes erupting at the same time. It was captured in February, 2010 by NASA's TERRA Earth-observing satellite as it flew over (the TERRA website appears to be down right now - this isn't rocket science, NASA!).

These volcanoes, and the microbes that live in and around them, are the reason why we're traveling around the world to see this place. Wherever magma is close enough to the surface to interact with groundwater, superheated steam can be forced toward the surface. Depending on the how much it cools before reaching the surface and the pressure under which it emerges, the liquid can for a variety of hydrothermal features; geysers, fumaroles and springs if the liquid emerges on land, and black smokers and white smokers if it emerges under water.

Along the way, the water dissolves various minerals and gases from the rock, and catalyzes the formation of new minerals and gases. By the time it emerges at the surface, it has become a complex suspension of minerals, gases and liquids, some dissolved, others suspended as a colloid, and others in bubbles and grains. I'm going to stop calling it "water" and call this stuff "volcanic liquid."

The chemistry of the emerging liquid depends on the chemistry, temperature, depth, thickness, packing and order of each layer of rock and soil it transits on the way to the surface, as well as the pressure and temperature of the liquid at each step along its journey.

A thermal pool at Lassen Volcanic National Park

My favorite way to explain how there could be so much variety in volcanic liquids is to think about coffee. It's possible to make several very different kinds of coffee from the same beans. If you grind them very fine, pack them tightly, and force steam through the grounds at high pressure, you get espresso. If you grind them even finer and suspend them in hot water as a colloid, you get Turkish coffee. If you grind them coarsely, suspend them in water, and remove them with a sieve, you get French-style coffee. If you grind them moderately, put them in a filter cone, and pour hot water through them, you get American-style drip coffee. They each taste totally different, despite being made from exactly the same ingredients.

Now, instead of coffee grounds, imagine many layers of rock, each with different chemistry, packing density, and thickness. Rocks, by the way, are pretty complicated things, and can be made out of almost anything. Practically every source of volcanic liquid from around the world has a unique chemical composition.

This variety is one of the reasons microbiologists are so interested in the organisms that live in these liquids. Organisms that live in the Earth's atmosphere, like you and me, have only a few attractive options for how we run our metabolisms. For organisms that live in volcanic liquids, every combination of dissolved and suspended minerals and gases offers its own unique metabolic opportunities. Volcanic structures tend to persist for a long time, and so their denizens have time to evolve very well-adapted strategies for living in these places.

Visiting these volcanic vents is like taking a trip to an alien world, or like visiting Earth when it was a radically different planet. Volcanic zones don't just look alien, they are alien!

An alien habitat at Lassen Volcanic National Park

I will be spending almost two weeks up-close-and-personal with some of these alien habitats, so there will be more to come.

This is the first in a series of articles I plan to write over the next three weeks covering my field expedition to Uzon Caldera and attendance the 2010 International Workshop on Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles. In this post, I'll outline my plans for the series and explain why I'm writing it.

If you would like to follow along, check in here, or subscribe to my RSS feed. Or if you would like to follow the series and not the rest of my blog, I will be tagging all of the posts in the series kamchatka. At Uzon Caldera, I will be posting updates to my Twitter feed by satellite phone (you can also subscribe to my Twitter RSS feed.)

Before I leave on Tuesday, I will post articles introducing the natural history of Kamchatka, my plans and preparations for getting getting there and working there, and maybe a few other things.

I have two broad goals :

• Study the biochemistry, genomics, and physiology of thermophilic organisms in their natural habitat.
• Document and share the experience.

These are two fairly distinct missions. First of all, I'm looking for material for my thesis, particularly a metagenomic target suitable for the technique I'm developing. For the hard science, I will try to confine myself to observations and avoid drawing conclusions. I'll save that for the journals.

The second mission is to bring you along. I've been asked by my thesis advisor to write about, photograph, tweet and film as much of the field expedition and the workshop as possible, and present it as an example of what it's like to actually do science. My goal is to present the company, the food, the work, the travel, the joys, the annoyances, the surprises, the good, the bad, and the ridiculous.

Science remains firmly misunderstood by the public. My personal experience suggests that the public actually understands the products of science -- powerful theories and key facts -- a bit better than polling data suggests. The core of public misunderstanding, I think, rests in how people believe science works as an institution and as a profession.

A couple of years ago, Fermilab invited a group of seventh graders to visit the laboratory to check out the various awesome things they have available for the public to see. Before the visit, the students were asked to write about what they thought scientists were like, and to draw a picture to go along with it. After the visit, they were asked to repeat the exercise. The results eye-opening. Here is an example I particularly liked, from a girl named Rachel :

before	after

Most of the before pictures feature lab coats filled by older, white men without much hair. Many of the kids mentioned that they thought scientists were "a little bit crazy," and most represented their scientist as some sort of authority figure. The after-visit results are equally interesting; many of the comments seem astonished that scientists have families, and that they enjoy things other than science.

The phrase "regular people" comes up again and again in their after-visit writing. Students are usually pretty good at ignoring phrases that are deliberately emphasized. When you see a bunch students incorporate exactly the same phrase into a free-form writing assignment, it's usually something that an adult mentioned without anticipating the impact it would have. The concept that scientists could be "regular people" was evidently a bit of a shock.

Obviously this is anecdotal, and it's important not to read too much into it. It is, however, a useful example of the sort of challenges we face if we want society to understand science itself, rather than simply memorizing the things science produces. None of this is original to me. If you want an entertaining treatment of science in the media, check out Christopher Frayling's Mad, Bad and Dangerous?: The Scientist and the Cinema (I apologize for the bizarre question-mark colon thing).

I've written about this before. Last November, I wrote :

The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.

Scientists have a responsibility to share what they do.

Over the next three weeks, I'm going to put that thought into action.

I just got the reservations for my flight to Petropavlovsk-Kamchatsky for the International Workshop on Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles, hosted by Moscow State University and Winogradsky Institute of Microbiology.

I've been working on the analysis of environmental samples from two sites at Uzon Caldera (about 10,000 Sanger reads from each sequenced at the JGI), and I'm hoping that I'll be able to reprocess the DNA here at the UC Davis Genome Center using some of our high-throughput machines. Licensing and customs restrictions will probably make it impossible to bring my own samples back, but I may be able to entrust them to a colleague with fancier credentials than my own.

Insofar as it will be possible, I will be blogging from Kamchatka and uploading photographs and data, so please ask questions in the comments!

I'll be arriving in Petropavlovsk on the 30th of July, with the help of a generous grant from the Carnegie Institution for Science Deep Carbon Observatory.

I went camping with some friends at Gold Bluffs Beach campground in Prairie Creek Redwoods State Park. It was pretty awesome.

I've had unusually good luck picking books to read in the last few weeks, and I thought I would share my thoughts about a few of them. I don't really want to review them, because I think reviews are boring. If you want to know what a book is about, then read it. These are my unsubstantiated opinions.

• The Windup Girl, Paolo Bacigalupi

  One of the most interesting and difficult challenges for contemporary science fiction writers is imagining the world after oil. Paolo Bacigalupi offers what I think is probably the most serious effort so far, though I think his calibration of technological progress (or lack thereof) is based more on media zeitgeist that anything else. Bacigalupi imagines an energy economy that has collapsed to human muscle power set alongside biotechnology of almost arbitrary power. It makes for a very unique world, and he accomplishes some pretty excellent storytelling. The story layers melancholy reflection with fast-paced action, but remains tightly cohesive.

• Ship Breaker, Paolo Bacigalupi

  Ship Breaker seems to be set in the same world as The Windup Girl, but follows a single protagonist, rather than a cast of characters. Ship Breaker paints Bacigalupi's imagined history in clear strokes, whereas The Windup Girl paints it with hints, unexplained references, and frayed ends that the reader must patch together on their own. Ship Breaker is more brutal but less bleak.

• For the Win, Cory Doctorow

  If you've ever played video games, you need to read this book. If you've ever read anything by Howard Zinn, you need to read this book. If you were paying any kind of attention to the Financial Crisis, you need to read this book.

  For the Win is a battle between two brilliant economists, a labor organizer from India and a Stanford-dropout quant from America. Doctorow highlights the astute observation that game economies are steadily becoming larger and more sophisticated, while the proliferation of credit default swaps, collateralized debt obligations and other various unregulated instruments have made our financial system more like a giant video game. They are linked; Doctorow merely imagines the link has grown deeper and more complex. The battleground of the book is the murky, crime-ridden middle ground shared by hedge fund managers, dark knights, child laborers, derivatives traders, Chinese crime bosses, bored American teenagers, and hundred-foot-tall zombie death robots. It's brilliant.

• Generation A, Douglas Coupland

  I never know if I should classify Coupland with Don DeLillo or with Neal Stephenson. His books thrive on the knife's edge between postmodernist absurdism applied to reality, and literate, profane realism applied to science fiction. Postmodernism places the rupture with reality in the interpretation of the world, and science fiction places the rupture in the world itself. Coupland's narratives exist somewhere between these two, and the effect is like looking into someone's eyes from up close, when the parallax is big enough that you waver from one eye to the other. The rupture slips back and forth between the interpretation and the world, and the effect is delightful.

• City at the End of Time, Greg Bear

  This book is worth reading for the atmosphere alone. The plot is an introspective adventure across dreams and time, and but the texture is what really sells it. If you appreciated the textured melancholy in Lord of the Rings or The Silmarillion, then City at the End of Time is definitely worth reading. Greg Bear raises the stakes and invokes the senses in a very different way, but the mood is like a Tolkien piece.

  A common theme in literature is the cruelty of time and decay. City at the End of Time confronts this directly, emphasizing the joy of time and change, and the horror of the alternative. Like Tolkien, the atmosphere creates a kind of intense nostalgia for the here and now.

• The Android's Dream, John Scalzi

  John Scalzi must have enjoyed writing this book enormously, and it shows. Every couple of pages culminates in a laugh-out-loud idea. It's brazenly ridiculous, but isn't as manic as Douglas Adams or Terry Pratchett. Scalzi seems to enjoy building up his absurdities into towering edifices, rather than sprinkling them around. They're not just funny in themselves; they're funny because Scalzi manages to pull them off.

• The Immortal Life of Henrietta Lacks, Rebecca Skloot

  This is probably one of the most important books of the year. Rebecca Skloot is thoughtful, compassionate and brilliant, and she put more than a decade of work into this slim little book. If it were fiction, it would be a brilliant accomplishment, but this is as real as it gets. This is a beautiful personal narrative, an ethics lesson, a call to action, a carefully documented historical account, an adventure, a science lesson, and a cogent critique of the culture of medical practice and research. If Skloot had pulled off only one or two of those things, this would still have been a brilliant book.

  It is clear that she cares deeply about the Lacks family, and when you're done with this book, so will you.

Last week, I got an urgent call from the National Marrow Donor Program. Somewhere, there is a girl about to go into chemotherapy, and my tissue type matches hers. They needed to run some more detailed tissue typing, and screen for infections diseases. The NMDP sent a kit to the UC Davis student health center (the new building is right next to my house), and I had my blood drawn this morning.

I hate giving blood. They didn't need very much, but I don't get along very well with steel needles. I count it as a major victory that I didn't barf until I got home.

Now we all wait for the results.

Good luck, whoever you are.

To steal the idea from John Scalzi, here is the last photograph of me in my 20s.

My twenties; better than my teens. Some good times, and some pretty awful times, and on average kind of meh. If the trend holds, my thirties should be in the tolerable to nice range. Hopefully the underlying process is geometric, and not linear or logarithmic.

Hence the awkward sort of half-smile.

Terry Young: She is gone
Sent: 2:54PM

I will miss her terribly.

I just retrieved my latest ceramics from the studio today, and I'm really happy with how they turned out. This is the first four of a series of twelve pieces glazed the same way, with a turquoise underglaze, a vibrant blue topglaze, and a buff-mix claybody with an aluminum oxide treatment.

This is my favorite piece, and the largest thing I've finished so far. It holds about 1400 ml. It's a little big to eat out of, but a little too small to really use as a serving bowl. I think I will use it mostly as decoration, but it could make a nice serving basin for two people, or maybe for serving a side dish, or something like that.

Now I have six more things to finish before the quarter is over!

After six months of using Google Latitude, I've amassed about 7108 location updates, or about 38 a day. It would probably be a lot more if I hadn't managed on occasion to break the GPS or automatic updating by fiddling with the software.

It's actually quite useful to have this data, especially if it's correlated with some richer information. For example, I've consulted the data to answer questions like, "Where was that awesome sandwich place I ate at last month?" It's also extremely useful to be able to share this data with Google because it allows me to quickly cross-reference location coordinates with Google's database of businesses and addresses. You can also download your complete location history in one giant blob (just ignore the warning that the History map only displays 500 datapoints, and download the KML file). Once you have the KML file, you can do whatever you want with it. For example, I uploaded mine to Indiemapper to map my wanderings for the last six months (Indiemapper is cool, but I quickly found that this dataset is really much too big for a Flash-based web application).

Not surprisingly, I spent most of my time in California, mostly in Davis and the Bay Area, with a few trips to Los Angeles via I-5, the Coast Starlight, and the San Joaquin (the density of points along those routes is indicative of the data service along the way).

The national map shows my trip to visit my dad's family in New Jersey and Massachusetts, as well as a layover in Denver that I'd completely forgotten about.

I have somewhat mixed feelings about this dataset. On one hand, it's very useful to have, and sharing it with my friends and with Google is very useful. It's also cool to have this sort of quantitative insight into my recent past so easily accessible. On the other hand, I'm not particularly happy with the idea that Google controls this data. I chose the word controls deliberately. I don't mind that they have the data -- after all, I did give it to them. As far as I know, Google has been a good citizen when it comes to keeping personal location data confidential. The Latitude documentation makes their policy pretty clear :

Privacy

Google Location History is an opt-in feature that you must explicitly enable for the Google Account you use with Google Latitude. Until you opt in to Location History, no Latitude location history beyond your most recently updated location if you aren't hiding is stored for your account. Your location history can only be viewed when you're signed in to your Google Account.

You may delete your location history by individual location, date range, or entire history. Keep in mind that disabling Location History will stop storing your locations from that point forward but will not remove existing history already stored for your Google Account.

...

If I delete my history, does Google keep a copy or can I recover it?

No. When you delete any part of your location history, it is deleted completely and permanently within 24 hours. Neither you nor Google can recover your deleted location history.

So, that's what they'll do with it, and I'm happy with that. What bothers me is this: Who owns this data?

This question leads directly to one of the most scorchingly controversial questions you could ask for, and there are profound legal, social, economic and moral outcomes riding on how we answer it. This isn't just about figuring out what coffee shops I like. If you want to see how high the stakes go, buy one of 23andMe's DNA tests. You're giving them access to perhaps the most personal dataset imaginable. In fairness, 23andMe has a very strong confidentiality policy.

But therein lays the problem -- it's a policy. Ambiguous or fungible confidentiality policies are at the heart of an increasing number of lawsuits and public snarls. For example, there is the case of the blood samples taken from the Havasupai Indians for use in diabetes research that turned up in research on schizophrenia. The tribe felt insulted and misled, and sued Arizona State University (the case was recently settled, the tribe prevailing on practically every item).

You can't mention informed consent and not revisit HeLa, the first immortal human cells known to science. HeLa was cultured from a tissue biopsy from Henrietta Lacks and shared among thousands of researchers -- even sold as a commercial product -- making her and her family one of the most studied humans in medical history. The biopsy, the culturing, the sharing and the research all happened without her knowledge or consent, or the knowledge or consent of her family.

And, of course, there is Facebook -- again. Their new "Instant Personalization" feature amounts to sharing information about personal relationships and cultural tastes with commercial partners on an op-out basis. Unsurprisingly, people are pissed off.

Some types of data are specifically protected by statute. If you hire a lawyer, the data you share with them is protected by attorney-client privilege, and cannot be disclosed even by court order. Conversations with a psychiatrist are legally confidential under all but a handful of specifically described circumstances. Information you disclose to the Census cannot be used for any purpose other than the Census. Nevertheless, there are many types of data that have essentially no statutory confidentiality requirements, and these types of data are becoming more abundant, more detailed, and more valuable.

While I appreciate Google's promises, I'm disturbed that the only thing protecting my data is the goodwill of a company. While a company might be full of a lots of good people, public companies are always punished for altruistic behavior sooner or later. There is always a constituency of assholes among shareholders who believe that the only profitable company is a mean company, an they'll sue to get their way. Managers must be very mindful of this fact as they navigate the ever changing markets, and so altruistic behavior in a public company can never be relied upon.

We cannot rely on thoughtful policies, ethical researchers or altruistic companies to keep our data under our control. The data we generate in the course of our daily lives is too valuable, and the incentives for abuse are overwhelming. I believe we should go back to the original question -- who owns this data? -- and answer it. The only justifiable answer is that the person described by the data owns the data, and may dictate the terms under which the data may be used.

People who want the data -- advertisers, researchers, statisticians, public servants -- fear that relinquishing their claim on this data will mean that they will lose it. I strongly disagree. I believe that people will share more freely if they know they can change their mind, and that the law will back them up.

Update

The EFF put together a very sad timeline of Facebook's privacy policies as they've evolved from 2005 to now. They conclude, depressingly :

Viewed together, the successive policies tell a clear story. Facebook originally earned its core base of users by offering them simple and powerful controls over their personal information. As Facebook grew larger and became more important, it could have chosen to maintain or improve those controls. Instead, it's slowly but surely helped itself — and its advertising and business partners — to more and more of its users' information, while limiting the users' options to control their own information.

For reasons I do not wish to fathom, my internet connection from home sucks whenever it rains. When I try to imagine why this might be the case, it calls to mind some truly horrifying images of what might be going on in Comcast's wiring closets.

How much does it suck? Well, here is a histogram of 200 ping times from my house to a machine at UC Davis, about 3000 feet from my front door. For comparison, I simultaneously collected 200 pings from my colo machine, which is 3000 miles away in Boston. The inbound and outbound packets from the colo go over Level3, so I've labeled it thusly.

Now, I wouldn't really expect a residential cable modem connection to measure up very well against a colocated server in terms of latency, but this isn't just a failure to measure up. This is just a regular old fashioned failure.

What ticks me off the most is that I pay $636 a year for this crap, and that my only alternative is AT&T DSL. I'd rather shave my tongue with a used bayonet than see a penny of my income fall into the hands of AT&T. Why does broadband suck in America?

I believe, Sir, that I may with safety take it for granted that the effect of monopoly generally is to make articles scarce, to make them dear, and to make them bad.
- Thomas Babington Macaulay

Some weeks ago, Buzz (my cat) escaped out my front door while I was carrying my bicycle into the apartment. For ten or twenty minutes, he romped through the ivy and bushes around my apartment while I followed him around rattling a bag of cat treats. Eventually, he let me pick him up and take him back inside. Naturally, he picked up a few fleas. Naturally, they have multiplied.

Oddly, the fleas don't seem to like Neil very much, nor do they like me. It's just poor Buzz that's beset by the nasty little critters.

Figure 1: A flea.

As it happens, I've been thinking about endogenous metrics for estimating the sampling quality of an environmental shotgun sequencing dataset, and Buzz's little problem presented an opportunity to play with a simplified problem. So, I have decided to make Buzz, or rather his fleas, into a small experiment in ecology. I am going to try to see if I can drive them into extinction.

Now, this is normally what a pet owner does when they discover their pet has contracted some sort of annoying parasite, but I decided to take a more quantitative approach.

Figure 2: A cat.

It's simple enough to count fleas on a cat, if the cat is willing to cooperate. Buzz loves the flea comb, and will gleefully hop onto the coffee table and wait to be combed if you show it to him. So, in the interest of science, I convinced my roommate to count the number of passes I made with the flea comb and how many fleas I captured (posterity will remember your efforts, Mehdi). Using his tally, I plotted the cumulative number of passes verses the cumulative number of fleas.

Figure 3: Fleas captured

As expected, it became somewhat more difficult to capture the next flea as more fleas were captured, suggesting a depletion curve. The value of the asymptote should be the actual number of fleas on Buzz at the time, and reaching that number would imply local extinction for the fleas. Of course, there are probably other fleas lurking about that would recolonize Buzz. In principle, if I were to repeat the exercise frequently enough, Buzz would become a sink for fleas, and their migration to his fur would gradually deplete them from the environment.

There are a couple of different ways to model the impact of the combing on the flea population, with various advantages and disadvantages. All we really want to do here is to estimate the value of the asymptote, and so a simple model is probably sufficient. I showed this data to my fried Sharon Shewmake, an economics graduate student. Sharon, after editorializing on the endeavor ("Ew."), suggested this very simple model.

Assume that Buzz is not going to sit still long enough for the fleas to reproduce, for more fleas to migrate to his fur, and that the fleas already on his fur are going to stay put unless captured. Thus, there is a fixed initial population which only changes as a result of capturing fleas. Next, we assume that any given flea is equally likely to be captured on a single pass of the comb. So, the expectation value for number of fleas captured on a single pass is the product of the current population and the probability of capturing a flea.

where N is the population of fleas and p is the probability of any particular flea being captured on a single pass. One could tart this up a bit by modeling it as a stochastic process and executing a bunch of Monte Carlo trials until the outcomes converge, but that seems like overkill for a simple single variable problem like this. We will put up with the intellectual inconvenience of capturing fractional fleas.

This is a little easier to see if we let N represent the number of fleas remaining on the cat, rather than the number of fleas captured.

If we stretch our credulity far enough to imagine this as a continuous function, we can express it as a differential equation.

Sorry if this bothers you. Not only are we extracting fractional fleas, but we are now modeling the combing process as a sort of flea-killing-combine continuously mowing its way through the fur. This is a model, so you shouldn't be surprised to find massless rope and spherical cows. Anyway, it has a nice easy solution.

Well, what the heck. This is a decaying function, so let's pluck a minus sign out of the exponential factor, and maybe tack on a scale factor for the initial population.

While we're at it, why don't we go back to letting the function stand for the number of fleas captured, rather than the fleas on the cat.

This gives us a nice function to use for a linear regression. A little help from scipy, and we find that the initial population is estimated at 39.7 fleas, and the decay factor is 0.011.

Figure 4: Flea population

I captured 34 fleas, so that means I missed about five or six. In order to be reasonably confident that I'd captured all 39 fleas, I would have had to continued for about 400 passes with the comb, instead of 173. Buzz is a patient cat, but he started to loose interest around 120 passes, and had to be fetched back onto the coffee table a few time times during the last 50 passes. My guess is that 400 passes would require some kind of sedative. On the other hand, he does seem to like Guinness, so there may be something to that.

Science has been served. I'm going to the pet store to buy some flea collars.

A few weeks ago, my dad sent me this really nice espresso machine to cheer me up. Actually, he sent it to me because it was it was his birthday. He's a pretty awesome dad that way -- I only sent him a book.

I'm still getting the hang of getting a decent pull of espresso out of it. I've found that my burr grinder doesn't quite go fine enough for espresso, so I'm going to have to take it apart and see if I can adjust the grinding wheels so they're closer together. Anyway, here is my latest effort :

Somehow this escaped my notice. Trader Joe's is building a new store in Davis! And right across the street from me, no less. Hurry up and bring the good eats, TJ's.

To my surprise, I learned this weekend that Davis has a lively population of burrowing owls, Athene cunicularia. How cool is that?

I took some nice shots, but Jonathan has a 300mm zoom, and I don't.

They're one of the few species of owl that is active during the day, though I think these guys were only awake to watch various chattering bipeds on the hiking trail. They seem comfortable with people getting within about 30 feet of their burrows, so you can get pretty close. If you go any closer, they start to do the "I don't like you" dance. If you ignore the display and keep getting closer, I'm not sure if they would run into their burrows or have at you with their claws and beaks. Owls will mess you up, even these little guys. At least they're polite enough to warn you, so heed the warning.

Spent the day writing a piece of code I already wrote six months ago. Not sure how I managed to forget. The new code wasn't very good, so I threw it away. Day down the tube.

Even asleep, Neil seems to understand.

I was feeling lousy today, and I heard that the internet was running low on pictures of cats. So, here are some pictures of my cats.

I normally don't talk a lot about my personal life on my blog, and except for the occasional announcement, I'd like to keep it that way. People's little triumphs and tragedies are mainly interesting to those directly involved, and are at best kind of boring to everyone else. A lot of my friends and family do read this blog, but by and large most of you are strangers or acquaintances. I try to respect that.

Those of you who are close to me know that I'm going through a sad time in my life right now. Those of you who work or study with me have probably noticed that I've not been my usual cheerful self. In deference to the many people who aren't here to read about that, and the fact that I can barely think about it (never mind write about it), I'm not going to discuss what's happened on my blog.

The one thing that has helped has been hearing about all the cool things that other people are doing. So, even though I'm not exactly Mr. Social right now, please don't take that as a sign that I want to be left alone.

On the contrary. Now would be a great time to tell me about whatever is on your mind, especially if it's cool.

To those of you who've been kind enough to treat me like a normal person over the last two weeks despite my melancholy behavior, I owe you guys. Really.

One of the wonderful things about web applications is that they can be available 24-7. They can sit there and quietly do their jobs -- taking orders, billing credit cards, assigning work orders, or whatever -- even when the office is empty. That's one of the main reasons one would go to the trouble of putting a web front end on something in the first place.

So, the question of the evening is, does the UC Davis registrar know this?

Um... no.

This is a completely automated process. If you do this during the daytime, it just goes ahead and populates a table in whatever chthonic legacy database system that is swaddled in this blob of early 1990's vintage web programming. It's not like having the office open at the time actually helps.

Attention Amazon.com shoppers! It's 4:45 Central Time, and Amazon.com will be closing for the day in 15 minutes! Please complete your order before the site is disconnected for the evening. We will open again tomorrow at 8:30 A.M. Thank you for shopping at Amazon.com!

On the upside, at least it doesn't complain that my browser isn't supported. Yay.

The eye doctor in Davis confirmed that my magical eye bubble is central serous retinopathy. Here's a much better picture (now also on Wikimedia Commons).

That volcano-shaped thing is supposed to be a little pit (that's what "fovea" means).

I'm a bit pissed off that the Zeiss optical coherence tomography machine that the doctor used to take this image evidently keeps the data locked up in a proprietary format, and can only exchange data with other Zeiss products. The doctor says he can't even save a screenshot. The only way I could get this picture was by snapping a photo of the display with my phone.

I'm impressed with the technology, and I'm happy to pay for it. It's much better than the machine used to take the image in my first post about this, and allowed for a quick and unambiguous diagnosis. I just don't want to pay more for it than it actually costs. Ziess is taking a page out of Microsoft's playbook here by leveraging proprietary data formats and locked-down data sharing to coerce doctors into buying their equipment instead of someone else's. Except, the stakes are higher for medical products.

Back in May 2007, I decided I'd try writing a Wikipedia article. I can't remember why I was seized by the impulse. I think I was supposed to be studying for something, and I'd already cleaned the bathroom and organized my closet. I pondered for a some time on the problem of selecting a topic obscure enough not to have a page already, and yet not so obscure as to become a target for the dreaded Deletionist clan of Wikipedians.

And lo, the Tasty Bite page was born. Looking at the page traffic, I fear that it will eventually become my most widely read piece of writing.

Well, they are pretty tasty. Oh, and those very mediocre pictures? I took those myself, and then consumed the contents of the pouch. Also, my friend Srijak says there is no such thing as "Bombay Potatoes," but he eats them too.

Dr. Robert Lustig at UCSF gave a very interesting public lecture for UCTV on the relationship between sugar consumption and a host of health problems, ranging from obesity to diabetes to gout. I won't reiterate his argument, but the kernel is that he has bestowed the term "poison" on fructose. By "poison," he means poison in the same sense that alcohol is a poison. Fructose and ethanol are both chemicals that causes health problems, and that only the liver handle. Keep in mind that if the body were a city, the liver would be the part of town with the scary industrial stuff, all pipes and loud noises smokestacks and funny smells.

In the lecture, he suggests that fruit isn't necessarily bad, because fruit tends to come along with fiber, and fiber slows down the rate at which the sugar hits your blood. This gives your gut microflora a chance to get at it and metabolize it into less harmful compounds (though with the unfortunate but health-neutral side effect of flatulence).

Anyway, this got me wondering. Which sugars are in which fruit? Not all sugars, or fruits, are equal. So, here's a nice chart I made from some data I found somewhere on the internet.

I computed the ranking by generating a "badness" index as follows :

It makes me a little sad to see apples, pears and mangos down there at the bottom, though I'm delighted to see avocados at the top. Also, I would like to remind you that not everything that is quantitative is scientific, and making a nice chart of some data you find on a random web page is certainly not scientific.

Over the summer, my dad decided to buy a nice little go-to scope for looking at the assorted planets and galaxies in our neighborhood. He wanted something relatively simple to operate so he could maximize the number of cool things seen in a given amount of time. He asked me if I could fine something with good optics and a usable go-to system -- the optics to keep him happy, and the go-to system for the assorted small children people keep bringing over and setting loose in his house.

Since I'd been playing with a couple of other Celestron products, I recommended either the Meade LT-6 or the Celestron NexStar 4SE. Honestly, I'd hoped that he would choose the LT-6, but since it costs about twice as much, he opted for the 4SE instead.

I'm out in Nantucket for new years, so I finally got a chance to try out the telescope this evening. The viewing conditions were not ideal (extremely windy and bitterly cold, and my right eye isn't still isn't back normal yet), but I think I can conclude that the telescope itself is pretty nice. I'm a little less impressed with the mount and the NexStar go-to system, though in fairness I haven't given them a fair shake yet.

And shake is indeed the watchword, I'm afraid. This was supposed to be Mars :

Admittedly, there was a bit of wind, but the telescope was planted firmly on a large stone pad and I used the time delay feature on my camera so that I wouldn't be touching anything when the shutter fired. This was only a 1 second exposure, so the shaking is pretty bad. I guess if you are hoping to do some astrophotography, don't bother with NexStar mounts. It feels good and strong, but it vibrates. Your eye can follow along just fine, but it sucks for taking pictures.

The telescope itself might actually be pretty good for basic astrophotography. Like a lot of Cassegrains, the 4SE has two optical ports with a mirror to switch between them. Celestron makes simple T-adapters for several models of SLR cameras, so you can bolt your camera body directly onto the second optical port. If you already have a DSLR, using it with the 4SE is very easy. Experimenting with 4SE and my Nikon D50 body seem fairly promising. Here is a shot I took looking through the window, which is laden with fingerprints, dog-nose-prints, and other assorted examples of encrustation and slobber :

Well, it's kind of easy, if you're comfortable using your DSLR in full manual mode. This is one area where I think the consumer telescope makers are missing a big opportunity. All DSLR camera bodies these days have some sort of interface for talking to the lens bolted onto its adapter ring. This allows for all sorts of nice features to work, like automatic light metering, autofocus, image stabilization, selecting F-stops, and so on. My Nikon D50 even has a little motorized driver to push the focus ring of autofocus lenses that don't have their own motors. There are lots of third-party companies that make lenses that work with various SLR bodies, so the interface standards must be obtainable. Why not make a smart T-adapter? A really basic, non-motorized autofocus lens for most DSLRs can be found for around a hundred bucks. I bet a lot of people would happily pay a hundred bucks for a T-adapter with a light meter and an autofocus driver. You'd have a point-and-shoot telescope, and all the brains to make the image capture work would be in the camera body. Which would be awesome.

I'm going to try again tomorrow night. I'm going to try keeping the tripod legs fully retracted, and hopefully there will be less wind.

About three days ago, I noticed a funny purple splotch in the middle of my right eye's visual field. It looked sort of like the splotch you'd get after seeing a camera flash, so I figured it would go away. Instead of going away, the next day it was bigger and darker. The day after, it was dark enough that I couldn't read with my right eye.

So, I decided it was time to put my health insurance to work -- which was pretty naive of me. Since I'm away from campus, I had to get a referral from an emergency room doctor (Anthem will only accept referrals from the UC Davis campus health center, or from an emergency room MD). Neither the cost of the emergency room visit nor the eye doctor was enough to exceed the deductible, so it all came out of my pocket (and Mimi's pocket). The deductible resets at the end of the year, which is in about a week. Lame.

Anyway, I was worried that it was some sort of retinal detachment, and was relieved to learn that it wasn't. Evidently, I have what amounts to a watter blister under my retina. Here it is :

Evidently, these things are usually stress-induced. Weird.

Also, I thought this was pretty neat. Here's my optic nerve :

Cool, huh?

Update : Well, the bubble got a lot bigger today, but space distortion started to go down. I think that means it's widening and flattening. I read up a bit about this kind of problem, and they are almost stereotypically associated with stress-addicts. I didn't think the last quarter was particularly stressful -- I rather enjoyed it. I've certainly had academic terms where I felt a lot more stress.

Usually, when I notice stress, it means that I'm feeling really unhappy about what I'm doing. The normal effect of that feeling is to make it harder to do whatever it is I'm doing, which I've always vaguely regarded as personal weakness. But if I can push myself hard enough to get blisters under my retina when I'm happily chugging along on my work, that makes my loss of productivity when I'm unhappy seem a lot more rational. I can almost imagine that it's a safety valve to prevent me from burning myself out -- at least on something that sucks.

So, I'm going to take this as a good thing. I've never been able to excel at classes I don't like, even when I found them to be very easy. No matter how motivated I was to "just get it done" (the advice of practically everyone in my life), something always sapped my energy. I'd pile on effort, and find that the effort required for the task seemed jump up just enough to absorb most of the extra effort I put in. But being unhappy and being under stress are not the same thing.

So, if I cheerfully worked myself into a stress-induced retinal blister, that's a pretty good indication that I've found something that bypasses my brain's "this sucks" filter. Now, I suppose I'll have to stop relying on my weirdly strong disgust with things that are boring to protect me from injuring myself. That's not a bad problem to have, actually.

Of course, all of this could be utter hogwash. I might have given myself a mystery eye bubble by reading all of John Scalzi's books in a week.

The calculus on the health care bill is very simple. If Democrats create a law that forces people to give their money to private insurance companies, and fails to create any sort of publicly administered alternative, the American people will hate it.

Conservatives and libertarians will hate it because it tramples on their freedom of choice and because it costs more than it ought to. Liberals and progressives will hate it because its a giveaway to companies that are widely agreed to be Evil Incarnate. Centrists will hate it because it won't work.

This isn't a "starting point" that can be refined as time goes on. It is a step in the wrong direction -- awarding even greater power and money to the already too-powerful insurance industry. It will give the industry the ability to raise premiums even higher and faster because people will legally have no choice but to pay them.

All major pieces of legislation evolve over time. They tend to do a better job of doing what they were designed to do in the first place. This was true for Social Security, Medicare, and many other social programs. It would be true for this healthcare bill too. The problem is that this healthcare bill doesn't do much of anything for citizens. It simply makes a gift of our freedom and livelihoods to the insurance industry, pure and simple. The bill will indeed evolve over time; the wussy regulations it creates to protect patients will get stripped out the instant the Republican party controls the government again.

I can swallow the idea of paying taxes to support a public service -- if the public service actually works. I cannot swallow the idea of being legally obligated to buy a product from a private party.

It's amazing. The Democrats in the Senate have actually managed to find an arrangement of circumstances that would actually be worse than the status quo. That's quite an accomplishment, given the breathtaking moral bankruptcy of our health insurance system.

Kill the bill. It will sink us.

My mom is doing some species survey work for the Navy, and got interested in these insanely tiny Chalcid wasps. Some of them are smaller than a grain of sand wingtip-to-wingtip, so it was pretty difficult to identify them under her binocular dissection microscope. I suggested maybe she should try out a consumer digital microscope before trying to get her grant coordinator to spring for anything huge and expensive. She picked up a Celestron microscope on sale from Amazon.

Obviously, it's not going to perform like one of the Nikon or Leica lab scopes, but it cost about one thirtieth as much, and it's humorously easy to use. If she can use it to zero in on the features used to identify these things and easily document what she sees, it'll do.

Here's what I was able to capture with a Chalcid wasp in ethanol with no slip cover. No effort was made to orient the objective, stain it, or improve the contrast. I just focused and hit the capture button.

Hmm... Looks like it might actually be usable with a little practice. The depth of field is not great, though.

I've been curious about the feasibility of making usable lab equipment as mass-produced consumer products. This scope is probably good enough for some specific problems, but not as a piece of generally usable lab equipment. But it's not as far away as I expected, actually.

One of the cool things about living in Davis is the amazing number of unique creative enterprises and projects people open up to the public. I suppose Davis is a comfortable place for people to try things out.

If you live in Davis, you should try Sasha's Soup Club. After a few weeks of envying the tasty lunches my labmates were enjoying, I joined the mailing list. I just received my allotment Leek and Potato soup, delivered by Sasha herself.

What can I say? It's damn good soup, exactly as described. The flavor of the potatoes and leeks both stand out nicely. Whatever else is in it, the other flavors are there to make a nice background.

I get nervous about making things with so few flavors. When I aim to make a simple soup, it will usually end up with six or seven different ingredients with strong flavors. If one of them comes out a little weak, you can still enjoy the others.

My general approach to hobbies is massive over-engineering. This is why the computer desk I built for my mother is rated for 7200 pounds (I tested it by stacking dead tractor engine blocks on top of it). I know that I'll never make a living as a chef or as a furniture builder. But if I build something, goddamnit, it's not going to fall down. So, when I make soup, or a sandwich, or a salad, I keep adding ingredients that I'm sure will taste good until something in my head says, "Yup, it'll hold."

It's greatly reassuring to me that there are people who know how to make awesome things with simple economy. I know I can make potato leek soup myself; I made some just last week. It was good, but then again, anything would be good if you loaded it up with enough garlic, onions, cheese, olive oil, peppercorns and sea salt. I wouldn't have had the confidence to make this soup.

Now, the only problem is not eating it all before I have a chance to gloat over it at lunch.

Now that I have a free moment between chopping potatoes and mashing them, I figure I should post the paper and talk I wrote summarizing my first lab rotation.

I tried to make the paper look like an PNAS article, but alas, their LaTeX template leaves much to be desired. I like how the talk turned out little better, thanks the wonderful Beamer package for LaTeX.

Mimi and I spent a good chunk of yesterday trying to print a three page PDF document. First, her dad's year-old HP OfficeJet 6300 stripped a gear in its paper feeder with no paper in the loading tray. It now seems to be beyond repair. So, we went over to her cousin's house, and a her HP all-in-one choked on a strangely formatted paper size directive. The error codes suggest that the printer's firmware got corrupted, but we couldn't get any more detail on account of Vista's printer stack simultaneously shitting itself, and remaining resolutely shat even after the usual Windows hokey-pokey of uninstalling/reinstalling, rebooting and banging the table and swearing.

We emailed the damn thing to her sister at her office, and she spent an hour futzing around with it before getting it to live uncomfortably on an 8.5"x11" sheet of paper, only to discover that someone had swiped the fuser wire from the big office laser printer. Six hours after we started, the three pages finally emerged from an old printer Lan found somewhere in a closet.

This seems to be the normal experience when you want to print an important document. Why is it still so awful? Why do people not riot in the streets and burn HP executives alive on pyres of new-but-broken plastic-crap printers? Why do people continue to allow PostScript to live?

One of the projects I've been working on this semester is designing a teaching unit for the UC Davis introductory biology curriculum. The introductory biology courses are required for a whole bunch of different majors at UC Davis, so all three of them are offered every quarter. It's a huge effort, and thousands of students take these classes every year. This is part of a teaching seminar led by Scott Dawson (don't bother Googling for him -- you'll find the wrong guy). The idea behind Scott's seminar is to take the half-dozen or so concepts that the BIS2A, 2B and 2C students struggle with, design teaching units aimed at those topics, and then try them out on volunteers. My topic is stochastic processes, which has been great fun. The project isn't finished yet, so I'll save the details for later.

One of the other issues we've been addressing in the seminar is how scientists relate to non-scientists. This is, for obvious reasons, an essential teaching skill. Even if they hope to be scientists someday, students are not scientists. If you don't find a way to talk with them about science, then you're wasting their money and their time.

The idea that the educator is largely responsible for the success (or failure) of the student hasn't really seeped into higher education, although it's been the standard thinking in primary and secondary education for decades. Not all elementary school teachers are good at what they do, but it is generally agreed that if they are good, the results will be seen in the subsequent success of their students. In higher education, things don't really work this way.

The most often cited reason for poor instruction at the college level is that many professors consider teaching secondary to their research. While this is clearly true in many cases, teaching in higher education doesn't just suffer from playing second fiddle to research. Many, many professors (even whole departments) who take teaching seriously are nevertheless not very good at it.

There are two causes, both of which are systemic problems. First of all, people who teach at the college level are usually not trained as teachers. Many (most?) professors have no education training whatsoever. Yet, even if you have natural skills, teaching isn't something you can do effectively without at least a little theory and training.

The result is that most of the teaching in colleges is done by amateurs and autodidacts. In contrast, at the primary and secondary level, teaching has been a job for trained professionals since the turn of the last century.

The second problem, which is partly a symptom of the first, is regular old-fashioned chauvinism. It is the responsibility of the student to learn, but many professors fail to see how they fit into this. This might be acceptable at a private, endowment-supported institution, but such places are exceptions. The Harvards and Oxfords of the world are free to treat their students however they like, but public institutions are ultimately responsible to the taxpayers. The taxpayers support such institutions for two reasons; to conduct research, and to educate their kids. Sink-or-swim pedagogy is a dereliction of duty.

This is a problem that extends far beyond the classroom. I was listening to NPR on the drive down to Los Angeles, and caught a story on All Things Considered about the reception of Darwin's On the Origin of Species. Some extracts :

"That fraction of people who figured that they could and should keep more or less up to date with what was happening in geology, in botany, in zoology, even in physics and mathematics is a much bigger fraction than it is today," says Steven Shapin, a Franklin L. Ford Professor of the History of Science at Harvard University.

...

"We hear about scientific findings," says Shapin. "But the proportion that can evaluate them and follow along with them, as opposed to hearing about them, is very, very small."

Shapin says that since people can't be completely conversant with the relevant science, "They're looking for an answer to the question, 'Who can we rely on? Who's speaking the truth? Who can we trust?' "

I think the good professor is missing the point. The problem is not simply that science has gotten more complicated and technical. It is true that there is more of it, and that it moves faster. The reason I don't buy Dr. Shapin's argument is that this is not at all unique to science. Everything moves faster and is more technical now than in 1859, and people seem to cope just fine.

The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.

Darwin's target audience for Origin -- the typical educated Briton in 1859 -- would not have much of an advantage on the average American in 2009. A Victorian gentleman would probably have had better handwriting and more patience for trudging through elliptical turns of phrase than an American high school graduate, but I don't think they would have much of advantage when it came to comprehending an unfamiliar scientific topic. The advantage Darwin's audience had was that it had Darwin.

When a good teacher notices that a student is failing to learn something, they will look first at their own teaching methodology for the problem. The same goes for scientists; when the general public doesn't understand or care about a scientific topic, a good scientist should look first at how they are publicizing their work. If the public doesn't think your research is important, then either you aren't explaining it well enough, or maybe it actually isn't very interesting.

Looks like I got my gene to grow in E. coli!

The colonies that didn't get the plasmid I'm using to carry MXAN7396 turn blue when grown with X-gal (bromo-chloro-indolyl-galactopyranoside). The ones that got the plasmid don't.

Neat!

I finally got through the double-PCR phase of the protocol without wrecking something. Yay!

My hacked up version of the gene gene is getting snipped up with everyone's favorite restriction enzymes (BamH1 and EcoR1). Then I get to splice it into a plasmid, and electroport the plasmids into some cells, and maybe they will do something interesing.

I've been doing my first laboratory rotation in Mitch Singer's lab, and trying to learn what people are actually doing when they publish these spiffy experimental results. So far, I've mostly been wrecking things. Fun disasters of the week :

• Wrecked a DNA extraction by grabbing the wrong Pipetter and putting 300 microliters into a tube instead of 3.
• Misread an illegible label and used butanol instead of ethanol, destroyed second attempt at the aforementioned DNA extraction.
• Dropped the wrong tube in the trash, screwed up the third attempt at the aforementioned DNA extraction.
• Kept a gel on the UV bench too long while trying to chop out little cubes with a razor blade, annihilated all the DNA, and screwed up fourth attempt at aforementioned DNA extraction.
• The PCR cycler didn't close correctly, and my reaction tubes evaporated; screwing up fifth attempt at aforementioned DNA extraction. (At least this one wasn't my fault.)

I'm now spending the evening in the lab running everything over again, for the sixth time. Yays!

I definitely sticking to informatics -- that part of the rotation is going pretty well. I'm just not cut out for benchwork.

PG&E is no angel, but it deserves credit for making what looks like a good-faith effort to get California off of carbon. It's serious enough to have quit the US Chamber of Commerce to distance itself from the group's extremist views on climate change.

PG&E still owns six coal burning power plants, curiously located in Florida, New Jersey and Pennsylvania (presumably it uses them to swap power with other generators). It generates about 46% of its electricity from hydroelectric dams.

Rucker Creek dam, a small PG&E facility in Nevada County

One of the more interesting projects PG&E is undertaking is improving the resolution of its demand monitoring using SmartMeters. There is a lot of hype about the "Smart Grid," but basically it boils down to realtime use monitors, like these :

that are wired up to report the data somewhere. It's basically an off-the-shelf Tweet-A-Watt.

According to the PG&E web site, they are using SmartSynch meters, which use TCP/IP over some kind of wireless network. It's difficult to find information about the hardware itself, probably on account of the assorted idiots wetting their pants about people h4X0ring their refrigerators (actually, I don't know if Bill Mullins is an idiot, but his article about smart meters is depressingly typical).

Yes, it is possible for a bad person to break into your PG&E account to obtain this data.¹ But so what? Power meters are inductively coupled to the circuit they measure. They can look, but they cannot touch. IOActive, a security research firm, claims that they can break into certain smart meters and "cut off power." I suppose we are meant to construe this as "cut off power to the house," but that isn't what power meters do. That is what those huge knife switches, with the lock-out-tag-out rings, are for. I'm skeptical that a certified electrician would work on a residential circuit with a computer controlled on-off switch. I certainly wouldn't. What "cut off power" probably means is that they can shut down the microcontroller, and stop the meter from collecting or reporting data. We're left to speculate, though, because the report is confidential. I speculate that they are hyping a buffer overflow exploit to gain as much attention as possible.

Nobody is going to h4x0r your refrigerator and reprogram it to be an E. coli chemostat. If you are worried about your personal data floating around on the big bad internets, your worries are better directed at your bank and your health insurance provider. The bad guys don't care that you left your bathroom light on all night last Thursday; they just want the routing number for your savings account.

While the data isn't very valuable for nefarious purposes, it is extremely valuable in the noble (if mundane) pursuit of frugality. Here's what PG&E shows you if you've been upgraded to a smart meter :

Having the graphs is neat, but the usability of the site is poor. Fortunately, they let you download the data as CSV files, although you have to go a week at a time. It's all very 1995. Happily, Google.org is working on a real-time data browser tool called Power Meter which will make this a lot nicer. For now, I just wish I had an XML-RPC interface.

I've already learned something from this data. On the 29th and 30th, I was at the Granlibakken conference center for the UC Davis Host Microbe Interaction conference. Those days show dramatically less power use between about 22:00 and 2:00, which is when I'm usually hacking at my desktop machine. One more reason to start thinking about replacing this behemoth.

1. Actually, it's stupidly easy to gain access to someone's PG&E account if you have their account number. Just create a new web account, type in the account number, and there you go! Now you can really fuck with them by paying their bill, which is about all you can do with a PG&E account.

I was going out to the garden to wash off the cat-litter-scooper this evening, and I noticed a tiny bat clinging to my screen door. It was hanging out about knee level, and I was worried my cats would take an interest in it. So, I tried to shoo it away, but it just chirped at me and clung onto the screen harder.

I thought maybe it was hurt (or worse, sick), so I captured it in a plastic bowl to observe. It didn't do anything to evade capture, and allowed itself to be sort of gently scooped up by the edge of the bowl. It walked around a little and chirped, but didn't do try to escape.

Since it didn't seem to be interested in flying around the apartment, I transferred it to the lid of the bowl, where it allowed itself to be photographed. I put a bead of water near its nose, which it prodded a little but didn't seem to drink.

I brought it outside again to see if I could get it to fly away. I held the lid out over a soft patch of ground and lowered it quickly, it spread its wings but didn't fly. I tried a few more times, and got it to fly as far as the fence. Finally, some tapping on the fence convinced it to flap away.

Does anyone know if this is normal behavior for this kind of bat?

I finally got fed up with the pathetic official Android release from T-Mobile, and rooted my G1 and installed the CyanogenMod firmware. Cyanogen feels about twice as responsive as Cupcake! It's like a whole new device.

Also, the tethering app is awesome. It turns your G1 into a WiFi base station and routes traffic from WiFi to 3G. Since I'm still waiting for broadband at my new apartment, it's a lifesaver.

I suppose tethering (and rooting the phone) technically violates T-Mobile's TOS, but I'm convinced that T-Mobile will allow both sooner or later. It's just too awsome, and it would help them sell more contracts.

It's kind of difficult to abuse tethering anyway; it sucks down the battery very quickly, and the latency is significant. It's the sort of thing you'd only use in a pinch. Those happen to be the situations where a little benevolence or selfishness from a big company can shape a customer's opinion forever. T-Mobile seems to be more sensitive to that kind of thing than the other networks. I know they've got their reasons for banning tethering apps, but I think they could be convinced to change their minds. (You can download various petitions from the Android Marketplace.)

Openness is where Google and T-Mobile could really go after the unwholesome, anticompetitive and un-American AT&T/iPhone alliance. The open nature of Android is a step in the right direction, but T-Mobile needs to get its legal department on the Open Access bandwagon if it wants to press the advantage.

After all, if some random people on the internet can roll better firmware for the G1 than their in-house developers, isn't it a strategic business advantage to let them?

I've been trying and failimg to get to sleep. The average interval of cat bombardment, and the mean momentum of the incident cat field has been unusually high. It took me a while to realize that this was related to the weather; it is lightly sprinkling. My cats have never seen rain.

That's a sobering thought in two ways. On one hand, they are old enough to have very well developed personalities, and yet are younger than the Obama administration by several months. On the other hand, it's been that long since it rained.

This summer has turned out a bit like a chocolate bar in the sun; everything started out nice and neat, but everything ended up squished into the bottom of the wrapper.

Right now, I'm working with Andrey Kislyuk on our little piece of the DARPA FunBio project. We're in the middle of a two-week code sprint, so I'll save that for a later post.

I also moved to a new apartment, and that didn't go nearly as smoothly as it could have. The guy we subleased from was in the process of buying a house, and the loan underwriter decided to yank back the money after he'd closed escrow (or was in escrow, or something). Evidently they wanted a sworn affidavit from the gardener that he was contracted to take care of the grounds. Anyway, the upshot was that instead of a nice leisurely move, he got stuck in the apartment for three weeks longer than he expected, and I was homeless for a week. Fortunately, one of the staff scientists in our lab was generous enough to let me stay at his apartment. Neil and Buzz got to learn about stairs, which they evidently adore.

Over Labor Day weekend, I went with Srijak and some of his friends from San Diego on a day hike at Lassen Volcanic National Park. I've always loved California, but it's nice to be reminded from time to time exactly why I love this place so much.

Because it's awesome.

For the last couple of weeks or so, Jupiter has been bright enough to cast a visible shadow on a moonless night. I'd been peering at it through the trees as I walk around town, thinking about buying a telescope. Then news came about the Black Smudge on Jupiter, discovered by amateur astronomer Anthony Wesley -- on a homebrew Newtonian -- and I thought, "That's it. I'm buying a telescope."

The problem is, I've never owned a telescope. When I was a kid, we had an ancient four inch refracting telescope, but it was missing some crucial parts, like the focusing drawtube, parts of the tripod, and one of the cast iron counterweights was broken in half (probably from coming unscrewed and dropping on the pavement). I played with it a lot, but for obvious reasons I never got to actually do any astronomy with it. When I lived in Ohio, I once used the Natural History Museum's incredible 500-mm Dall-Kirkham Cassegrainian to peer at Saturn.

Almost all of my telescope knowledge I owe to my college Optics course and its lab section, and the endless mind-numbing, poorly worded homework problems involving lenses and mirrors and pictures of carrots (I never found out why the objective was always a carrot). I could probably design a simple telescope on paper, but calculating a magnification factor and peering through a scope are very different experiences. I've been rummaging through telescope reviews on the internet for years, wondering how much I would really care about this or that optical aberration, or if I should spend more money to have less of it.

I decided to buy a really inexpensive telescope just to have a point of reference. This is what I've been playing with all weekend :

This is a Celestron FirstScope, purchased from Amazon.com for $43. Stephen R. Waldee wrote a ridiculously detailed review of this little thing.

When I was in eighth grade, everyone had to buy a Texas Instruments TI-82 graphing calculator. At the time, I had a computer (an elderly Macintosh SE loaned by a friend's mother, who had upgraded to a Quadra), but this was back when compilers were comically expensive. I could run programs, but I couldn't write them. The TI-82 wasn't as powerful as the Mac SE, but it did have a very well designed built-in BASIC interpreter and a fantastic library of functions. While my algebra teacher was tediously reviewing the previous day's homework, I tuned out and taught myself programming, Boolean algebra, functional formalism, iterative numerical methods, graphics, animation, and all sorts of other cool and useful things. Those stolen hours in eighth grade led directly to a degree in physics, four years working as a computational physicist, and graduate school in computational biology. The TI-82 was available, and it was extremely well-designed despite its limitations. In fact, I learned as much from what the TI-82 couldn't do as I learned what it could.

That's kind of what I have in mind for the FirstScope.

Anyway, I've been having a grand old time looking at Jupiter and the Galilean moons. Here's (more or less) what I've been seeing :

This is a 1 second exposure using a Takahashi TOA-150 that I rented for a few minutes using Global Rent-a-Scope. This guy beats the stuffing out of my telescope (the Takahashi is a $27,000 instrument!), but I'm really not using it for its intended purpose. What I see with the 4mm eyepiece on my telescope is essentially the same as what you see above.

I checked Stellarium to see which moons are which. From left to right, it's Callisto, Ganymede, Jupiter, Io, Europa, and the star HIP 107302.

Jupiter will occult HIP 107302 later today. This is kind of neat, since HIP 107302 is bright enough to see with the naked eye (at least when Jupiter isn't near it). If you Google for "Jupiter HIP 107302," you'll find that it's the brightest star Jupiter will occult for the next hundred years. Light from HIP 107302 will illuminate Jupiter's atmosphere from behind, and, I presume, yield some interesting data about its structure and composition for people suitably equipped to make such measurements.

Just for fun, and to be fair to the Global Rent-a-Scope people, here's another shot I took around midnight of Andromeda that really shows off the Takahashi's beautiful optics.

This is a 600 second exposure. I could probably do better if I fiddled with the exposure a bit, or did a color series instead of a single exposure, or knew anything about post-processing astrometric photography.

I've looked at M31 with my own little telescope, but all I see is a dot where the central core is. On the other hand, I was using the telescope sitting on the hood of a car in my apartment building parking lot under an obnoxious buzzing outdoor lamp. No night vision whatsoever. My verdict is that I've already gotten $43 worth of astronomy out of the FirstScope, and I haven't even used it under decent viewing conditions.

Here are a couple of random cool things that aren't quite enough for a post on their own, so I'll stick them together.

It's been absurdly hot in Davis. Since the summer started, I've lost about nine days of productivity on account of my brain being too hot to function. By the time I get to the heavily air conditioned Genome Center building, I spend the rest of the day wanting to stick my head in a bucket of ice water.

Happily, the evenings tend to be very pleasant. And no, I'm not going to take Nate Silver up on his challenge. Good on you, Nate.

On Saturday, the Mondavi Center hosted Dengue Fever for a free concert on the quad. They are really great live! Chhom Nimol got all the little kids in the audience to come up on stage and dance. It was a great show.

My labmate Lizzy just adopted an adorable rescue puppy of unknown origin named Dweezil. He is very sweet, and already very well adapted to life with humans. He seems to love everybody, but Lizzy especially.

Meanwhile, my own rescue animals continue to puzzle me. Why does Buzz like to sleep behind my monitor? It's hot, and the cutter on the tape dispenser keeps poking him in the head and causing him to emit annoyed grumbling noises and squirm around. There are lots of comfy places he could sleep, but he likes this spot for some reason.

If you should happen to be filling out a longish web form (say, for example, a blog post) using the Android browser, and someone calls you, the browser will dump all your windows and obliterate the POSTDATA. Gee, thanks. That's exactly what I wanted.

Come on people.

A guy in my apartment building just fell down the stairs right in front of my bedroom window. I put my glasses on and saw a puddle of blood slicking the concrete walkway, about ten feet from my pillow. About half the blood was coming out of his forehead, the other from a seep in his shirt where his collarbone is.

I went outside to see if he was moving. He wasn't. He didn't respond when I spoke to him. So, I did the logical thing -- I grabbed my phone and I called 911.

And it fucking crashed. So, I tried again, and it crashed again. I was in the process of ripping out the SIM card and charging up my old phone when the Davis 911 dipatcher called back. The good news is that the EMTs were fast. As soon as the dispatcher hung up, I stepped out to the street to wait for them, and I could already see the lights coming up the street.

So, listen here Google, T-Mobile and HTC: FUCK YOU. Fix your shit.

A little more than a year ago, my mother installed 14 SunPower 230 watt panels on her roof. After a year of production, my mom's solar array has produced 5.3 megawatt-hours of electricity. That's about $1500 worth of electricity production.

Her actual use was about 3 mwh, yielding a surplus of about 2 mwh over the year. Rock on! Pasadena Water & Power won't actually write a check for the balance, but are carrying it forward indefinitely. Eventually, I suppose, they will figure out a way for her to cash in. I figure that someday she will be able to buy an electric car, and the extra production (plus the surplus stashed away in her utility bill) will go toward charging it.

Before installing the panels, she had whittled her electricity usage from about 32 kwh a day down to about 13. I thought it would be interesting to see the how things look now.

I decided to invert the Y-axis to represent net energy balance from the homeowner's point of view. Negative numbers represent net consumption, positive numbers are net production. The green region indicates the interval since the panels were installed. PWD bills on a bi-monthly basis, so unfortunately there are not very many data points.

The panels were installed in the middle of a billing period, so the first data point lifts away from the prior trend, and settles on a new trend. The third point in the green region -- the one that dips back into the negative -- is the middle of winter. Production was lowest, and my mom was running a space heater at her desk to keep her feet warm.

After it started to cool down yesterday, I went for a bike ride around the research farms, and I saw what I thought was a seam in the bike path. It wasn't until I was almost on top of it that I noticed that it was the shadow of a snake crossing the path! I ran over the poor guy before I could hit the breakes.

Fortunately, the snake survived, and went slithering into his hidey hole in the roots of one of the huge trees that line the bike path. I used a stick to touch the end of his tail to make sure his spine wasn't broken, and he reacted in about the way you would expect a not-run-over snake to react.

Sorry this isn't a very good picture. Since T-Mobile pushed out the Android Cupcake upgrade, my phone has been ridiculously, pathetically slow. It took almost a minute and a half to get the camera application open and snap a picture. By that time, the snake had spent 30 seconds slithering around on the bike path checking itself out (which would have been an awesome shot), and then gone about 20 feet into the grass. Boo Android! Fix your shit!

The snake was about four feet long and about the width of two fingers. The head was sort of bullet-shaped, as opposed to shovel-shaped, so it's probably not a viper. My guess is garter snake.

In the last 24 hours, my cats have learned four things.

1. Maximum face nuzzle! The larger (as yet unnamed) fellow really likes to nuzzle people. It's his thing. He climbs up on your chest, at pushes his hot dry nose into your face as hard as he can. A few days ago, he discovered that he can increase the nuzzling intensity by winding up a bit, like a pitcher throwing his own head. Yesterday evening, he discovered that he could increase the nuzzling intensity even more by getting a running start, and face-planting into my face while I'm reading.

   He is now starting from the hallway, and using the corner of my bed as a springboard to launch himself at my head at a full gallop. He tucks his paws under his belly and closes his eyes, so he comes in like a little furry nose-missile. I dare not get out of the way, or he'll hit the wall behind me and hurt himself. About half the time, I managed to catch him before he hits me.

   His little brother sits quietly on top of the pile of books next to my bed, and watches his larger brother do this with a sort of sad, disappointed expression on his face.

2. Do not eat dental floss. They climbed up onto the sink, opened up the medicine cabinet, and pulled down my dental floss. They then managed to unravel the whole spool by chasing it around the legs of the kitchen table. Thusly restrained, they then proceeded to eat the dental floss, one cat at each end. I woke up to two very sad kittens, attached to each other by their pyloric valves, separated by about twelve inches of knotted dental floss. There was a lot of puke everywhere. I carefully pulled the floss out of their throats, which led to more vomiting. They hated it, but didn't struggle or scratch. They looked very surprised once they felt better.
3. Stink beetles taste terrible. This hardly needs elaboration.
4. Falling in the toilet is not fun. This evening, the larger fellow decided he was suddenly interested in the toilet bowl, which he's never cared about before. Perhaps this was part of a quest today to gain as many disgusting experiences as possible. He followed me into the bathroom while I was hanging up the towels from the laundry, and I could stop him, he scrambled up and over the seat and into the bowl head first. He seemed genuinely shocked to discover that he could not avoid the water at the bottom. Vigorous thrashing and yowling commenced. His little brother looked on from the threshold, looking grave and embarrassed (as usual). I pulled him out, and he stopped yowling, and stuck him into the shower, and he resumed yowling.

   Now he smells like Irish Spring, and keeps casting suspicious glances at the toilet. A few minutes ago he followed me into the bathroom again, and did his threat display (puffy tail, arched back, hissing, sideways-walking) at the toilet. His little brother, once again, observed from the threshold with a grave and embarrassed expression.

I've adopted two kittens! They were captured with their mother in a feral cat colony out in the farmland somewhere around Davis. As much as I love cats, feral cats are a terrible ecological problem; they eat their way through the native bird population astonishingly quickly. The mother is supposed to be a champion huntress, which is kind of bad. She is too wild to become a house-cat, but fortunately not wild enough that she would have to be put down. Evidently she's been spayed, and will eventually gain employment as an official rodent control officer at a farm or vineyard, safely away from nesting areas.

However, I have a problem. I don't know what to name them! They have provisional names, but they're already growing out of them. They are brothers, so I'd like to name them accordingly. If you know any good names of brothers, or brothers-in-arms, from history or literature, please post below.

Candidate names are :

• Buzz and Neil
• Romulus and Remus
• Castor and Pollux
• Lio and Erasmus
• Watson and Crick
• Wilbur and Orville
• Yuri and Glenn

I tried to think of some characters from Shakespeare, but most of the brothers in the plays murder each other, or do other dastardly deeds. Not very fitting for these two guys. They are just about the least mischievous kittens I've ever met. The worst they do to each other is to induce unwanted consciousness via squirming.

My article on bike safety is in print in the Davis Enterprise! I was invited to write this column as a follow up to my Davis Crash Map article and Anna's accident in 2007.

It's not up on their web site yet. I'll update with a link one they post it.

:: update ::

Here is the text of the article :

The Davis Enterprise: June 19, 2009
Davis Bicycles! column #20
Title: When road design gets personal Author: Russell Neches

Two years ago my little sister was riding her bicycle to a friend’s house. A woman was diving home from work. They met when the car hit Anna at 30 mph.

Before I go further, Anna is OK.

The weeks following the accident were hard. Aphasia, hematoma, and dental prosthesis became a regular part of family conversation. It was a month before we were sure she would get better.

Anna lives in Norman, Oklahoma. Norman is a lot like Davis; it’s roughly the same size, population and distance from the state capital. Norman hosts a big university and encourages bicycling.

After the accident, I desperately wanted someone to take responsibility. At first, I blamed Anna for not being more careful. Then I read the police report, and blamed the driver. But when I visited Norman and stood by the splashes of dried blood on the asphalt, I found I couldn’t blame either of them. The blame belonged to the road itself.

In sharp contrast to Davis, Norman has some of the sloppiest road design in America. The road where the accident happened has no curb, no sidewalk, no lane markings, no lights, and no center divider. The street is a smear of asphalt that informally fades into gravel and scrubby grass on its way to becoming front yard. This wasn’t some lonely country road. It happened downtown, right next to the University of Oklahoma. The equivalent spot in Davis might be about Seventh and E Streets. Until Anna’s face slammed into the windshield, the driver had no way of knowing for sure that she was driving on the wrong side of the road.

Davis does a pretty good job when it comes to road design. Even out amongst the farms, most of the roads have reflectorized lines to mark the center and shoulders. This isn’t because paint is cheaper in California. It’s because public officials have found that the lines help people be safer drivers.

With Anna’s final round of reconstructive surgery still in the works, I hope I can be forgiven for being preoccupied with bicycle safety. I’m a scientist. When scientists get worried, we go back to the data. Mapping the last couple of years of Davis accident reports indicates that the biggest problem spot in our town is the much-debated Fifth Street corridor.

It has been proposed to transform the stretch of Fifth Street north of downtown from a higher-speed four-lane road with frequent stops into a lower-speed two-lane road with center turn pockets. The design would look somewhat like B Street does now. I was surprised to learn that the two roads carry about the same amount of traffic.

Not everyone likes the idea, and some warn that slowing traffic may result in congestion. This must be taken seriously, and so detailed computer models have been constructed. The models show that the proposed design would actually increase throughput and reduce congestion somewhat.

This counterintuitive result is something with which I have personal experience. I grew up in Los Angeles, the poster city for congestion. It got that way because people tried to solve congestion problems by adding lanes. What we got for our billions of dollars was even worse congestion. LA has more acreage under roads than under destinations, and yet it is still asphyxiated.

Roads are ancient technology. Roman engineers would find California’s freeways impressive, but would learn little from them. But even ancient technology can be improved. We didn’t get from swinging stone axes to landing robots on Mars by refusing to try new things. Lane reduction has been tried in other cities, with great results for safety and efficiency.

The proposed Fifth Street design sounds like something worth trying. It will make Davis a safer, more efficient place walk, bike and drive. Repainting and installing different signals is part of the normal process of maintaining and improving roads. The proposal would simply guide this process. If it doesn’t work, the city has more paint. My family learned the hard way just how important lines of paint really are.

I’ve made an interactive map at vort.org/media/data/crashes.html displaying the last couple of years of Davis accident data. I hope it will inspire you think about how our roads are designed, how those designs succeed, and how they can be improved.

— Russell Neches is a microbiology graduate student at UC Davis. He has commuted to school and work through Los Angeles, New York and Boston on various vehicles including bikes, cars, trains, subways and on foot.

:: update 2 ::

Here is the direct link to the article on the Davis Enterprise website : http://www.davisenterprise.com/story.php?id=621.3

I received my buccal swab kit from the National Marrow Donor Program. It took about three minutes to prepare. It's about as hard as brushing your teeth.

I especially like the biohazard sticker for sealing the sample card. Then, you just stick it in the mail.

They'll do the tissue typing, and (hopefully) add me to the database of marrow donors.

Seriously, why haven't you signed up yet?

Dear Iranian Security Forces:

Welcome to Vort.org, now from Tehran. Please spend as much time looking at this page as possible. There are lots and lots of links to follow. Who knows what important security information you will find? It is very important that you read every single post on this blog. Carefully. And discuss each of them with your superiors.

I may have scattered the names and locations of many active dissidents in old posts on my blog. Then again, maybe I haven't. You won't know until you look. Please take your time.

You can be from Tehran too:

<meta name="ICBM" content="35.696189, 51.422961">
<meta name="geo.position" content="35.696189, 51.422961">
<meta name="geo.placename" content="Tehran, Iran">
<meta name="geo.region" content="ir">

If you can read Hebrew well enough to find the right contact form on their damn web site, please tell Bezeq that the following IP addresses are part of a botnet:

84.109.41.197
84.109.105.38
84.109.42.218
84.109.105.30
84.109.105.218
84.109.120.173

That is all.

Starting today, the first 46,000 who sign up can join the National Marrow Donor Program for free. Tissue typing normally costs about $50, so this is pretty neat.

I don't get along very well with needles, but this is kind of, you know, important. And it's fairly unlikely that any particular donor will be asked to donate. Tissue matches are very specific, which is why it's so important to get lots of people in the database.

If you are Asian, or any sort of nifty minority, then it's extra important that you sign up. If you are mixed race, then it's very important.

Mimi lost a friend to cancer this year because they couldn't find a marrow match. There could have been one more name called at her graduation if there'd been just a few more biracial hits in the marrow database last year.

Look at it this way. Superman saves people all the time, but he has to go through all sorts of bother and trouble with the secret identity and such. A few days of lower back pain seems like a pretty awesome deal in comparison.

If I'm ever asked to donate marrow, I'm getting a cape.

Now that she's all graduated and stuff, Mimi came out to Davis for my birthday this week. She took me to this place in Napa called, of all things, Ubuntu. Not only is it a nice word in Zulu, but it's also a Linux distribution, a restaurant and a yoga studio. Anyway, they were the runner up for best new restaurant of 2008 in the New York Times Food & Wine section.

It was delicious, but kind of difficult to describe. Evidently, the chef walks out into his garden each morning, peers at the ripening ingreedients, and invents the day's menu based on what's ready to eat. Neat!

Anyway, Mimi is here in Davis until Friday. We're having a great time biking around town and doing Davis-y things.

On Friday morning, a fellow named Boris and two of his friends got on their bicycles for a ride. As they pedaled along, observing the speed limit and traffic rules, a speeding truck overtook them. As it bounced over a speed bump, it's rear door swung open and snagged a parked car, and flung it across the road. It came within a few inches of crushing Boris and his friends.

So far, the event I've described above seems fairly unremarkable. Things like that happen all the time. There are two unusual things about this crash, though. First of all, the incident was caught on tape by a security camera, so we know exactly what happened. The three near-victims were Lord Adonis, Kulveer Ranger, and Boris Johnson; the UK's minister of transport, the director of transport of the city of London, and the mayor of London, respectively.

Helmet in hand, the mayor of London walks over for a better look at the car that almost killed him. This iPhone shot is by user Beatnic on Flickr under a Creative Commons license.

The three were cycling through London to scope out possible routes for a system of protected bicycle "super-highways." Mr. Johnson had the following to say about the incident:

"I am relieved that no-one was hurt, but this incident reinforces the need for us to make London's roads safer for cyclists, which I am determined to do and to make London the best city for cyclists in Europe.

"Cycle Super Highways, which are part of our record investment in cycling, will play a central role in this, providing clearly demarcated routes for cyclists that lorry drivers and others will be aware of."

What does this mean for American cities? I would take three lessons. First, London is huge, cramped, and damp. Yet London is looking to bicycles as a significant part of its transportation mix, and the city government takes it seriously enough that the mayor himself is regularly out surveying bicycle routes. Bicycles are a serious metropolitan transportation system, not just a recreational activity. Relative to London, cities like Davis are in a much stronger position when it comes to cycling; it should press its advantage.

Second, helmet laws and cycling safety initiatives are important, but even the most careful cyclist -- even the mayor of London -- can do very little to protect himself from a rampaging truck.

Third, out-of-control vehicles are depressingly common. If you want bicycles to play a serious role in municipal transportation, you must deal with vehicle safety.

As if vehicle safety weren't worth pursuing anyway! 43,000 Americans die every year in car accidents. That's like one 9/11 hijacking every month. Bringing this number down will take more than airbags and antilock breaks. It will require making some changes in the way we drive, and the roads we drive on.

NASA's Earth Observatory posted a fantastic article yesterday about a big computation effort led by Paul Newman, a scientist at the Goddard Space Flight Center. Newmans's group set out to answer the question, "What would have happened if we had failed to regulate CFC gases?"

CFC gases were essentially banned in 1989 through the Montreal Protocol, the world's first international environmental treaty of global scope. So, what did we avoid by banning CFCs?

Newman's group found that we avoided a previously unanticipated runaway cascade of ozone depletion, which would have led to a nearly complete loss of UV protection over the temperate and tropical regions -- not just over the poles.

The year is 2065. Nearly two-thirds of Earth’s ozone is gone—not just over the poles, but everywhere. The infamous ozone hole over Antarctica, first discovered in the 1980s, is a year-round fixture, with a twin over the North Pole. The ultraviolet (UV) radiation falling on mid-latitude cities like Washington, D.C., is strong enough to cause sunburn in just five minutes. DNA-mutating UV radiation is up more than 500 percent, with likely harmful effects on plants, animals, and human skin cancer rates.

By the end of the collapse, the UV index would have exceeded 30 in temperate North America. A UV index greater than 10 is considered extremely dangerous.

We're talking about radiation levels similar to Hiroshima in the days following the atomic bomb (though at a different spectrum), except across the whole planet, every single day, for centuries. A walk on the beach on a sunny afternoon would have been permanently disfiguring, and possibly lethal.

Instead of this hellish scenario, CFCs peaked around the year 2000, and they're already down about four percent. The simulations predict that the ozone layer should finish healing by about 2065. Sweet.

We saved the world, at least from that particular disaster. What did we sacrifice? Basically, nothing. We had to switch to different refrigerants, and it took a few years before people figured out how to make air conditioners that worked as well as the old ones. It might even have been a net positive for the economy, since it accelerated engineering innovation and equipment upgrades, and thus efficiency.

Carbon dioxide is going to be a bigger challenge. We emit a lot more carbon than CFCs, and the things we do that emit carbon are, for the most part, much more fundamental to our economy than running refrigerators and air conditioners. Nevertheless, the Montreal Protocol is a valuable lesson. It shows that politics can influence the world in positive ways, even when everything is a mess. 1989 was not exactly a banner year for political stability, good leadership, or economic strength.

Mimi just called a few minutes ago to say she finished running her half-marathon! Neat!

Now she just needs to finish her thesis...

The term "alternative energy" annoys me. It is a sloppy bit of wordsmithing. Do we really have an alternative to this?

No, actually. We don't. It's obvious, by simple inspection, that the scene above cannot continue. Even if we wanted to continue making electricity this way, it is impossible. Any activity this intensive and inefficient will run its course very quickly. It could happen in several ways, but the simplest and surest way it will stop is that they will simply run out of coal.

On one hand, we have a few reasonably non-destructive means of generating energy, like wind and solar. On the other hand, we have idiocy and crime. How is it alternative energy when there is essentially no choice?

As I've pointed out, coal is responsible for most of our carbon emissions, but provides less than a third of our generating capaicty. That is stupid. I suggest we dump the terms "green energy" and "alternative energy," and simply call those things energy, and use the term "dumb energy" to refer to coal.

Interesting thing of the day : If you plug the following nucleotide sequence into Google :

"gctagttaaa aaaggaaatt catacccaaa"

The only hit you will find is the Swine Flu genome. Google is a sequence homology tool!

I want announce a little project I put together over the weekend. For want of a better name, I'll call it the Davis Crash Map. Basically, I analyzed the accident report spreadsheets from the City of Davis Public Works Department, and made an overlay for Google Maps to visualize the data. The spreadsheets are a bit difficult to analyze, so I'm leaving out the reports that aren't clear to me (about 15% of the reports). The reports that gave me some trouble seem to be randomly distributed over the city, so the overlay should still give an unbiased picture of what is happening.

In particular, this is map is intended to examine bicycle accidents. I hope people will look at this map, and think about how they behave on the roads, weather on foot, on a bicycle, or in a car. How you behave on the road has direct, and sometimes dire, consequences for you and for other people.

However, there is more to this than behavior. This is also a design question. Roads are not natural features. They are designed and built by people for use by people. As with anything that is made by humans, there are good designs and bad designs. These designs have a real impact on peoples' lives. In the case of streets, the impact on your life can be very literal, as this map shows.

Even good designs can always be improved. Davis is a pretty safe town in which to walk, bicycle and drive. But if you study this map, and think about it as you go about the town, it's also clear that things could be better.

I'm not a traffic engineer, or a civil engineer, or a city planner. I claim no expertise in those areas. I'll leave it to other people to make specific suggestions. However, I think it is important for the users of streets -- pretty much everybody -- to think about what kind of streets they want. This map should help give you a better idea of what kind of streets we actually have.

For some reason, people seem to get very emotional about traffic. I grew up in Los Angeles, home of the nation's worst traffic jams. Perhaps this is to make up for our lack of a professional football franchise. Passions about transportation, especially mundane things like parking spaces and HOV lanes, get people really worked up. Los Angeles is also famous for road rage, and nowhere is it in greater evidence than in the corridors of City Hall. Public meetings on traffic can make I-405 look like afternoon tea. In fact, thousands of people from all over the world tune into the internet broadcast of the Santa Monica city council meetings to listen to Californians scream at each other over the exact position of little blobs of paint on little strips of asphalt.

What the conversation needs, I think, is some perspective. Data can help provide that perspective, especially if it can be represented in a way that is easy to understand. Maps are good at that.

If you will indulge me, I'd like to share my perspective on this data. Each marker represents a traumatic event for someone. Under some of those markers, a life came to a sudden, violent end. I'd like to share a picture of what kind of event a marker on this map represents. You won't find a marker for this event because it happened in Norman, Oklahoma, a college town that is a lot like Davis.

Anna and me

In October of 2007, my little sister was riding her bicycle near her house. A lady in a Mercedes made a lazy left turn, and crossed onto the wrong side of the road. She hit Anna head-on. Anna went up and over the hood of the car, and face-planted on the windshield, breaking her nose and her front teeth. The lady slammed on the breaks, and Anna then went flying off the car and slammed her head on the pavement. That much is clear from where my mother photographed the tire marks, the blood stains, and scattered teeth.

Who designed this street, anyway?

The sequence of events afterward are a little unclear, since Anna does not remember anything from that day, or for several days before and after the accident. The police report includes several details that are impossible or don't make any sense; for example, the officer thought she was coming out of a driveway onto the street, but the driveway did not belong to anyone she knew, and was paved in gravel (extremely annoying to bicycle on). The report also places the accident on the wrong side of the street, which was obvious enough based on the tire marks and blood. Based on what her friends say she was doing -- biking from her house to a friend's house -- she would have just been pedaling along the side of the road. The details of what happened are somewhat unclear, other than the evidence left on the road and gouged onto my sister's face.

After hitting the pavement, she evidently got up and staggered around for a bit, and then collapsed. She stopped breathing, and officer on the scene couldn't find a pulse, and assumed that she was dead. This was the reason given for not immediately summoning an ambulance.

Then she suddenly revived and started mumbling. The lady who ran her down went into screaming hysterics, and had to be restrained (or evacuated, or something). It was only then that an ambulance was called. From the report, it appears that paramedics and police spent a good deal of time tending to the driver of the car, who was having an anxiety attack, instead of Anna, who was bleeding from massive head trauma.

Anna then spent the next several days in the hospital. My mother got on the next flight to stay with her. For the next several days, Anna went through long and short memory lapses and dizzy spells of various lengths. When I spoke to her on the phone over the next several days, she also had some kind of aphasia, which was very jarring to me because she is normally a very articulate person. And then there was the puking. Brain injuries often come with a heavy dose of overpowering nausea. She was on anti-nausea drugs for a long time after the accident.

It took a long time for he to start feeling "normal" again. Almost two years later, she's still not sure she feels completely normal. Fortunately, thanks to some really great work by her surgeons, she looks normal. Needless to say, she is both very lucky and very tough.

Anna's bicycle. The police kept it as evidence, but allowed my mother to photograph it.

You could say that I have a personal stake in this, and I will not claim to be unbiased. Many people who argue against safety measures that would slow traffic argue their case on the basis of personal responsibility. We are each responsible for our actions, they argue, and if you do something stupid, you are responsible for the consequences. Why should people who don't do stupid things be inconvenienced?

I agree completely. However, if one casts any real issue into the frame of personal responsibility, then things are rarely so simple. Everyone who could act in a situation has responsibilities, even if they are not they are directly involved. When you have the power to prevent something bad from happening, and you choose not to act, then some of the responsibility falls on you. Every unfortunate, stupid thing that happens involves a cast of thousands of silent, but not blameless, bystanders.

We have a responsibility to at least attempt to protect people regardless of what they are doing -- even if it is stupid. This is especially true when it comes to the things we build. We shouldn't, if we can possibly avoid it, build things that injure and kill people. If we can think of ways to make something we build less dangerous, we ought to give it a try.

Anna and Earnie, about a year after the accident.

My little sister was stupid not to wear a helmet that day. The lady in the car was stupid not to have been on the lookout for cyclists. But neither of them deserved what happened. Each of them is obviously bears some measure of responsiblity (and I have my own opinions on how those measures are apportioned), but the city of Norman also is also responsible. The city didn't even bother to paint a line down the middle of the road; what was the driver supposed to be on the wrong side of?

Yes, this is about personal responsibility. We, the public, build the roads. We are responsible for the markers on this map, and all the terror, trauma and tragedy they represent. Let's try to do better.

I've been tinkering with a little data visualization applet for looking at bicycle crash data in Davis, and I thought this map might be interesting to people. This is a image was generated with Google Maps and a heatmap overlay generated with a gheat tile server.

This is for 168 bicycle accidents that happened between 2004 and 2006. I have a lot more data, but 95% of the work in this little project involves parsing and renormalizing it. Evidently, police reports are not written with data processing in mind! I suppose that makes perfect sense. An officer at the scene of an accident probably has things on her mind besides generating a nice, easy to parse data point for future analysis. The priority seems to be completeness, rather than consistency. My parsing code, for example, has to be able to correctly detect and calculate distances measured in units of "feeet".

I'll release the applet here once I make an interface for it (and get the rest of the data imported). Stay tuned.

I'm not sure if I'm glad or sorry to have missed this conversation.

I was biking home today, and I decided to take a detour to enjoy the warm evening (and to avoid the not enjoyable warm apartment). About half way around the Davis Bike Loop, I remembered that I wanted to try out My Tracks. Here's the result : Neat!

After wandering off the Bike Loop a bit, I decided to head home. I was biking down Russell Blvd., and I witnessed a very scary car accident. The accident happened where I stopped recording the track, at the red marker. A guy in a cherried-out lifted F-150 was sitting at the traffic light (that's the point where I turned around). When the light turned green, he floored it. According to the other witnesses, he was racing with someone, or trying to catch someone who had cut him off. I couldn't see the other car because it was behind his gigantic stupid truck.

What I did see, though, was that he accelerated continuously until he reached the next intersection (the red marker), where he had a head-on collision with a girl in a 1990's Honda Civic trying to make a left turn. His engine was deafeningly loud even a block away, and I heard it roaring and down-shifting right up until the crash.

Looking at the damage to her car, it looked like he basically ran it over. The lift kit on the truck put his undercarriage about level with her roof, and there were even little ladders installed to climb up to the doors. After he ran over the Civic, he swerved around a bit, jumped the median, sideswiped a small SUV in the oncoming traffic, spun 180 degrees, and snapped his axle. When the axle snapped, I heard his engine redline for half a second and then cut.

Happily, nobody was hurt. The girl in the Civic was pretty much petrified, though. She was convinced that the accident was her fault because she didn't get out of the way.

I told her this was nonsense; the truck was going more than double the speed limit, and I'm pretty sure he didn't have his lights on (it was dusk, but not completely dark yet). She asked me about five times, "How much do you think it will cost to fix?" I told her, "Cost you? Nothing. He was committing maybe a dozen moving violations, and probably racing someone. His insurance company will probably be so happy not to have to pay medical bills that they will buy you a whole new car."

Maybe she could have been a little swifter completing her turn, but it's a busy street and there is a lot of pedestrian and bicycle traffic (it parallels a bike path). Making a quick turn is probably not a good idea. Or, maybe she could have waited until this asshole passed, but, as I pointed out, he was going maybe 50 or 60 in a 30 zone, and accelerating. She timed her turn right for reasonable traffic flow, but didn't account for total maniacs among the oncoming traffic. It would have been difficult to judge when he would reach the intersection she was turning through.

Oi!

As it turns out, Davis has been thinking about redesigning this stretch of Russell Blvd. for several years. If you look at the proposed design, it would have made this accident impossible or unlikely. You can't race on a one lane road, and a landscaped medium would have prevented the second collision.

I'd like to give a big fat raspberry to the X.org people today, and possibly the Debian X.org maintainers, for pushing busted X.org packages. Booo!

If you should happen to download said packages, you will find mouse and keyboard input on your computer completely disabled once the login manager comes up. If you log in via ssh (or boot with "single" in your kernel boot options), and look at /var/log/Xorg.0.log and observe the following,

(II) The server relies on HAL to provide the list of input devices.
	If no devices become available, reconfigure HAL or disable 
        AllowEmptyInput.
(WW) AllowEmptyInput is on, devices using drivers 'kbd', 'mouse' or
        'vmmouse' will be disabled.
(WW) Disabling Keyboard0

then you have contracted this particular affliction.

Dear X people, why the fuck would you make the default behavior to ignore properly configured devices? Especially when this can brick peoples' computers? Yes, I know about this. I stand by my raspberry. HAL still doesn't enable the right quirks for my motherboard, even though I submitted FDI files more than two years ago. HAL does not, and will not ever, work for everyone. When it works, it's nice, and I'm in favor of it. But please, please stop making life suck for people HAL doesn't help.

A pox on you all!

Anyway, the way you fix this particular bug is to add the line

Option "AllowEmptyInput" "false"

to the ServerLayout section of your xorg.conf file. For example

Section "ServerLayout"
    Identifier      "Default Layout"
    Screen          "Default Screen"
    InputDevice     "Generic Keyboard"
    InputDevice     "Configured Mouse"
    Option          "AllowEmptyInput"    "false"
EndSection

Props to K.Mandla for figuring it out.

A little while ago, I was riding home on my wonderful Brompton bicycle, and the chain tensioner suddenly disengaged. That had never happened before, and I discovered that the gear on the chain tensioner had completely smashed to bits. Here's what it looked like :

After puzzling about it for a while, I think I understand what happened. I use the same chain oil on my Brompton that I use on my racing bike. The "oil" is actually a mixture of a heavy lubricant in a volatile solvent. The solvent evaporates after coating the chain, and dissolves whatever gunk has accumulated. I think the solvent damaged the plastic. I've seen this happen with some plastics when they come into contact with gasoline. The gasoline dissolves the plasticizing agents, and leaves behind an open matrix of molecules, like a very, very fine sponge. The open matrix has a huge surface area and oxidizes rapidly. Your nice flexible plastic turns into something hard and crumbly, like a stale cookie.

That's what I think happened here. The remaining bits of plastic are still relatively flexible, but the bits that broke off have turned into a powdery mess.

The guy who sold me my bike offered to let me buy an idler wheel off of one of the bikes in his stock, but I didn't want another plastic gear. Here is what I built :

I bought a standard anodized aluminum derailleur gear from a local bike shop, and attached it to the Brompton chain tensioner arm with a few pennies worth of standard hardware. The new idler wheel (gear? cog?) slides along a little stainless steel tube I picked up at the hardware store and cut to length. This gives it enough play to allow for easy shifting. The tube has just the right tolerance to allow the gear to spin very easily, but not wobble.

Here's the exploded view :

From top to bottom, the parts are :

• regular old bolt
• two washers
• stainless tube
• gear
• another washer
• lock washer
• nut

The gear is part of a Shift Biscuits pully set (though probably any pully set would work), and the steel tube is 7.94mm x 7.4mm (stock No. 7117) cut to length with a hacksaw (this took a while). The rest of the hardware is standard hardware store stuff.

I had to saw off the plastic axle tube on the chain tensioner arm because it would have prevented the idler wheel from sliding into the right position for the outer gear. I chose a bolt with a hex-head that fit snugly into the socket on the tensioner arm (similar to the bolts on the toggles for locking the frame in place). Once the nut is tightened against the lock washer, the axle is extremely rigid. The gear slips across the tube with almost zero play.

The shifting action is actually much smoother than it was with the plastic gear, and the bike seems to make a little less noise than I remember (that could be my imagination).

Yay! I've got my bike back, and without another dorky plastic gear, too. Neat!

To my Iranian readers, happy new year! It seems president Obama is taking the opportunity to deliver a friendly message, too.

So, here's a link to the story on the BBC. Sorry, I couldn't resist. And sorry for the gratuitous alliteration.

Florence Itken, my great aunt, passed away yesterday. I was always very close with her growing up, and I lived with her for a year after I graduated from college. She was a great friend and teacher.

Flo was a teacher, in fact, from the time she was a little girl until the moment she slipped away yesterday. I thought I might share a few words about this great passion of hers.

Just as the Great Depression struck its most demoralizing chords, her father Solomon passed away, leaving the family to live off of my great grandmother's meager income as sweatshop worker. Like many first-generation Americans, Flo provided a lot of practical support for her mother, and helped her two sisters with their schoolwork. Flo was twelve, my grandmother Vivian was nine and my other aunt Selma was five. Florence spent her teenage years watching over her sisters's schoolwork and helping her mother.

Anna had missed the opportunity for formal education, and so my great grandmother was determined that her daughters would receive the best education possible. She had grown up in a rabbinical household in what is now Belarus, but she left for America (alone) as a young teenager. Later in life, she was an avid reader in English, Yiddish, Russian, and a bit of German and Hebrew. But until the Depression and the war were over, and her daughters safely making their way in life, all of that was on hold. Anna's hopes for her daughters' future depended on public education. Sight unseen, she placed those hopes on the University of California.

Whenever I think of their journey from New York to Los Angeles, I always think of Steinbeck's Grapes of Wrath, and imagine the surviving Itkens making their way among the bedraggled columns of Americans on the long road to California (though, I cannot imagine them tolerating any literal bedragglement). The fictional Joads fleeing the Dust Bowl for greener pastures of the California Central Valley, the actual Itkins fleeing the tenements of the Lower East Side for the sanctuary California classrooms. Fortunately, things turned out much better for the Itkins than the Joads.

All three of the Itkin girls went to UCLA, and all three of them became teachers. Florence became a colleague and friend of the great educator Corinne A. Seeds, for whom UCLA's Lab School is named. To give you an idea of the company Flo kept, you can read about Ms. Seeds (Flo always called her Ms. Seeds, even though they were close friends) in Pedagogies of Resistance: Women Educator Activists, 1880-1960, or if you're near Tufts, you can look up Professsor Kathleen Weiler, who is writing a biography of Ms. Seeds.

Barely out of college, Flo was one of the few people who publicly supported Ms. Seeds' opposition to the internment of Japanese Americans during World War II (for which both of them received death threats). Along with Ms. Seeds and others, my aunt was one of the shock troops of John Dewey's progressive movement. It is because of them that primary eduction is actually educational.

Flo was the principal of Kenter Canyon Elementary for, I think, about forty years. During her tenure at Kenter Canyon Elementary, it was the top-performing elementary school in the LA Unified School District. This was in no small part because Flo was an excellent teacher herself, and because she acted as a human firewall between her staff and "the conniving bureaucrats downtown," "the pencil pushers" and "the idiot school board." She retired on May 31st, 1980. Flo has teased me for my whole life on account of the fact that I caused my mother to miss her retirement party by arriving in the world on that particular day.

When I saw her on Saturday, she used what little energy she had to ask me three questions: How is school? When is Mimi graduating? Tell me what you've learned. Those were her last words to me, save three. To understand those three, I'll have to make a little diversion.

For Flo, politics was an integral part of being a teacher. She believed that a good teacher should fight for her students, and should not be shy about carrying the fight wherever it had to go. The task of an educator is to create opportunities for her students. That means that an educator is called upon to confront prejudice and ignorance when they threaten those opportunities. Flo believed that smashing social barriers was just as important as multiplication tables (although, this was not a simple distinction to her, since one can smash social barriers by teaching multiplication tables, depending on who was doing the teaching and who was doing the learning).

Of course, she didn't clutter up her classroom with politics. Education is a science, and she was a serious practitioner. Her politics was about clearing the road ahead of her students.

It came as a huge shock to me that her views were so forceful. She was the very model of an elementary school principal -- proper, patient, and professional. She was the sort of lady that hippies feared; she would have told them to wash up, given them The Look and used The Voice, and made them feel very foolish.

Flo kept her radicalism under tight control, unleashing it in calculated measures. The people who saw her act on those principles never knew what hit them. She only brought out the knives in board meetings and budget committees. Most of the time I knew her, she seemed like a funny, sweet old lady. But when Her Children (or students generally) were threatened, the sweet old lady was suddenly made of steel. She would, and did, go to war for her pupils and for her teaching staff. I suspect that her first objection to Japanese internment was that it took students out of their classrooms, and death threats weren't going to stop her from raising hell about it.

I was with Flo through the 2004 election, and she was devastated. George Bush was, in her view, a teacher's worst nightmare. He was a great propagator of ignorance, advocate of prejudice, a spoiled, dull child of a rich politician, and a conniving bureaucrat. Flo described the mandatory testing in the No Child Left Behind Act as "a bunch of skull-measuring" and "a jobs program for bad administrators."

A few days after Kerry lost, I was having breakfast with Flo and talking about the election. Flo waived at the double fistfull of pills she was trying to swallow and said, "Damn him, now I'm going to have to do this for another four years." Like all of Flo's Pronouncements, it was accomplished. She weathered four years of Parkinson's disease, heart failure, blindness, broken bones and (most painfully) the dismal news of the last four years so that she could deliver her vote for the sake of her students.

I asked her what she thinks of our new president. She gasped, and gave me the thumbs up. "I'm so proud," she said, speaking, I know, as a teacher.

Florence loved flowers, but if you really want to honor her memory, please do so by supporting teachers.

I wish the WiFi Alliance people would stop worrying about the maximum speed of the 802.11 family of protocols, and instead worry about improving cooperation among networks. When 802.11b was new and shiny, it was fairly unlikely that you'd have to worry about spectrum competition. Now, wherever you are likely to find one network, you are likely to find a dozen.

Usually, this kind of mess happens in residential areas, but I've seen it lab buildings also. I would be more than happy to route a few of my neighbor's packets on my network in exchange for less spectrum congestion. What is needed here is a protocol that would allow owners of clashing access points to decide who they are friends with.

Of course, this would mean that anyone who owned an access point would have to be able to assert common carrier status, which could have some interesting side effects.

As a Jew (or as some people might insist, someone of Jewish ancestry) and as an American, I'd like go on record and say that Avigdor Lieberman is a fucking piece of shit. So is his party, so his his loyalty oath, and so is everything he stands for. And I'd like to extend a big fat "Fuck You" to everyone who voted for him, and to everyone who signs his loyalty oath, and to every fellow traveler throughout history.

If you don't know who he is, imagine crossbreeding Ann Coulter, George Wallace, Sarah Palin and Joseph McCarthy, and then Bar Mitzvah the result.

I just got my first pieces back from glaze firing today! They turned out much better than I expected, though, honestly, I wasn't expecting much.

This is a smallish cereal bowl (about eight inches in diameter). It is, thus far, the most symmetrical piece I've made, and I'm really happy with it.

This was the first piece I threw. I haven't thrown clay since I was about eight years old, so this is the first in about twenty years! I was pleasantly surprised to find that it's actually reasonably usable and not altogether hideous.

After convincing Kyrgyzstan to evict us from our air base at Manas, Russia is evidently offering us transit rights to resupply our troops in Afghanistan. As I was looking at the map in the Sacramento Bee, I was reminded of what a logistical nightmare our operations in Afghanistan are. There is a reason the region has such a violet history; it has the most unfavorable political and geographical cartography on the planet.

And guess who is smack in the middle of it?

I made the map above as a friendly and non-scientific reminder about why diplomacy with Iran is so important to American interests. The outcome might not be a friendly Iran, but it would be really great if we could, you know, fly over it without getting shot at.

I went to see Kodo at the Mondavi center this Wednesday. I've been listening to Kodo since Mondo Head came out in 2001, and they just keep getting more awesome. I especially enjoyed Yoshie Sunahata's solo, which I'd not heard before.

I cannot stress this enough: Go see this show if you can.

I was reading Planet Gnome, and followed Pascal Terjan's post to the PyPy project, and decided to play around with it. I've been studying for midterms all day, and this looked like a mildly educational way of goofing off for half an hour.

After the initial amusement running some of my python code in a python interpreter written in python and running in another python interpreter, it occured to me that there is absolutely no way I could articulate why I think this is cool to someone who didn't already think it was cool.

Yet it is, nevertheless, kind of awesome.

Today is that last day of George Bush's presidency. I have waited eight years to write those words, and oh how sweet they are!

A good friend of mine remarked recently that while he liked reading my blog, it was depressing him. So I went back over the archives, and I realized that a lot of it has been pretty depressing. But then again, it's been a pretty depressing time for America, and I think a lot about national issues. There have also been some rough patches in my own life; my advisor at UCLA closed down his group and moved to the UK, and I had to figure out what to do with myself. That has colored my writing.

Tomorrow, two things are happening that believe will administer a stiff dose of optimism around here. First, America will be under new management. Second, I am scrapping my plans to work in physics, and joining Jonathan Eisen's lab. These are not wholly unrelated events, and so I decided to address them together.

First up, the big picture stuff.

On the evening of November 7th, 2000, I discovered rather to my surprise that I do, in fact, love my country. My recollection of the evening and the time that followed has an amusing resemblance to a romantic comedy; I played the insensitive jerk who doesn't appreciate his wonderful girlfriend until she is suddenly gone. Let's say, for the sake of argument, that she is carried away by baboons. Or perhaps Richard Gere. Or maybe Richard Gere playing a baboon.

Then, for the first excruciating half of the movie, I slowly begin to understand how much I needed her. I discover, to the merriment of all, that I cannot cook, that I don't understand money, and so on. The movie trailer features a memorable scene in which I am eating molding Chinese takeout in my underpants as my life comes crashing down around me.

Then, and epiphany! I should win back the girl from the baboons, or Richard Gere, or whatever. Some amusing side characters are introduced who help me on my hilarious and humiliating quest of self-discovery and girl-retrieving.

That's kind of how it went. Instantly, as soon as the results started to come in, I felt an icy lump in my stomach. When it became clear that George Bush was going to win, I started to recognize the feeling. It was familiar. The last time I had experienced it, I was a fifteen-year-old at the bottom of a drainage ditch, looking at how my right hand was twisted around backwards and resting backwards against my forearm, the radius snapped and the ulna cracked lengthwise and telescoped into itself.

The most lucid memory I have about breaking my arm was that it did not hurt. The pain came much later, after everything was nicely set and wrapped up, and the doctors had explained that it would heal nicely. But at the bottom of the drainage ditch, there was this very singular feeling. Not fear, or pain, or surprise, but cold, icy dread, like the firmware of my brain had suddenly broadcast the message, CRITICAL ERROR! and terminated everything else in my head. Emotions, ideas, thoughts, memories, all were gone. There was nothing but a paralyzing tsunami of Wrong! Wrong! Wrong!

That's what I felt on November 8th, 2000. Something terrible had happened. I had lost something really, really important, but I was too dumb to understand what it was. My country, which I had loved all along but never appreciated, had been carried away by baboons.

As the months and years unfolded, I got to know what I had lost from the shape of the hole it left. I discovered the first ragged edge of that hole during the Hainan Island incident. America suddenly seemed bumbling and weak, thundering with indignation and then groveling pathetically. The State Department evidently couldn't even be bothered to write the official letter of condolence for Wang Wei's death in Chinese, and so the CCP naturally translated it to sound like an admission of guilt. The Bush presidency was pretty much downhill from there.

But this is a romantic comedy, after all. I spent the summer of 2006 in Oxford, mostly apologizing for the idiot in the White House to all the nice people I met from the rest of the planet. I came home determined to get my country back. So I started researching candidates for the midterm elections. There were some really great people running, and so I sent in my tiny little donations over the internet. I signed petitions, sent grumpy letters to newspapers and did a little phone banking. Six months later, a nice lady from San Francisco became the first woman to wield the Speaker's gavel.

So, you get the idea. Struggles, setbacks, successes; lots of painful, cringe-worthy scenes that screenplay authors think are funny. I've got my country back, and I've learned my lesson. I'm never going to take her for granted again. Today, the credits roll. The movie is over.

The prognosis for the next couple of years is dismal. The economy sucks, our financial system has utterly collapsed. Wall Street is a financial Chernobyl; we've gone through the blackout, the meltdown, a series of ruinous detonations as various subsystems superheat and explode, and we are now watching it belch radioactive smoke into the Jet Stream as the whole thing slowly burns. We are also hurtling towards a point-of-no-return in the great phase diagram of atmospheric carbon. Oh, and we're fighting two wars.

Nevertheless, I'm pretty happy. Our problems have solutions. We've just elected a guy who has a very clear view of this colossal mess we're in, and doesn't flinch.

Now, I'll take a step down in scale a bit, and talk about why I'm leaving physics.

I decided to study physics for a very simple reason; our planet's atmosphere is filling up with carbon, and if we don't stop digging shit out of the ground and lighting it on fire, we're going to wreck the place. Like most people, I figured that we need a big source of energy that doesn't involve burning black stuff from the ground.

But the more I learned about the energy economy, the more I came to understand how wrong I was. Yes, we use a lot of energy. Most of it is from burning black shit we dig out of the ground. But for the most part, we fritter it away. We spend gigawatts lighting empty rooms, running idle computers and refrigerating nonperishable food. We blow a big fraction of our electricity into the night sky, benefiting no one, except perhaps future generations of alien astronomers. We blow billions of gallons of fuel driving to places we don't want to go, flying to places we don't want to see, and moving products we don't enjoy.

In the very near future, we're going to have less fuel and less electricity. And you know what? It's going to be fine. Little by little, prices will go up, and the waste will go away. In retrospect, we will see that most of the energy we use today was utterly and completely wasted. We will learn to waste less of it, and everything will be fine. People will wonder what the big deal was.

There will be some fancy technologies, like solar panels and wind turbines. I learned a bit about that by designing a solar array for my mother's house this summer. It generates more than she uses, cost about as much as a small car, and took three days to install. It will pay for itself in about sixteen years, or maybe sooner if rates keep climbing, and it will last for about 40 years. It was almost disappointing how straight-forward it was (though it was a lot of fun). Cutting her energy use from almost 40 kilowatt hours a day to less than 10 was totally painless. When it's time to replace the washing machine and the refrigerator, her house will draw less than 7 kilowatt-hours a day. The panels generate about 13 to 17 kilowatt hours a day; her last electric bill was negative $102.

In a nutshell, here is the solution to the energy crisis : Stop being a pussy.

We don't need to be "saved" from this. Not by fusion reactors. Not by advanced nuclear whatever. Not by magical carbon sequestration. The human race will have fewer gigawatts to play around with, and so we'll use them more carefully. The reality of the energy crisis is this: Our sense of entitlement and its associated low inclination to innovate is coming face to face with the laws of physics. Physics will win. Exit crisis, pursued by a bear.

Energy is neither cheap nor abundant. It never has been, and it never will be. If you don't believe me, get on a stationary bike and do 860 calories of work (you'll burn about 2400 calories, or three good meals). That's one kilowatt-hour. You will be tired as hell. Right now, you pay about a dime for that much work. No matter how you generate it, it's crazy to pay so little for so much. It should come as no surprise that there are hidden fees in the fine print, like "may destroy the Earth." Cheap energy was always a Faustian pact.

There are lots of good reasons to build reactor tokamaks, but cheap energy isn't one of them. Fusion would be a great power source for space exploration; the fuel is everywhere, you don't have to worry as much about radiation, and you get your vacuum pumping for free. Sometime soon, I think we'll do just that. But for now, I simply refuse to grind through all that horrible mathematics just so Cody McFuckhead can leave his X-Box running while he goes on spring break.

This is actually a delightful discovery. As long as I was getting my understanding of the energy situation from media sources, it looked very very grim. Things look totally different once you become conversant in the ways we make, transport and use energy. Climate change is a real crisis and a real problem, but the solution is anything but rocket science : Bulldoze all coal-fired power plants, and forbid the construction of new ones. Do it on a nice predictable schedule, and let utility prices rise just at a pace that allows people to keep up with the adjustments they have to make. Provide targeted aid where it's needed, like weatherizing and insulating houses for low income families. Space it out over ten years, and start with the utility markets that can adjust the fastest.

Bulldozing our coal fired plants would cut America's carbon emissions in half, an only sacrifice about 27% of our generating capacity. If organized carefully, utility prices would rise to less than $0.40 a kilowatt hour, and then fall to near previous levels as conservation measures come on line. Why is that so scary? We don't suffer from a lack of alternative energy, we suffer from a lack of balls.

I thought about this a lot over the summer. Obama's victory finally gave me the clear concience to change direction. The newspwpers are filled with hand-wringing about the budget deficit, but I'm more concerned about America's chutzpah deficit. Obama might not be able to fix the budget anytime soon, but he's already recapitalizing our country with a desperately needed infusion of guts.

I was always interested in the computational side of physics, and so a shift to computational biology is not as big a shift as I'd feared, especially since I am only just starting. It's a different world, and I'm already starting to feel that it's a better fit for me.

Energy has always fascinated me. "Follow the money" was Mark Felt's advise to Bob Woodward during Watergate. If you want to understand politics, economics and history, money is the skeleton that gives shape to events. The currency of the universe is energy. It is the specie of all things from galaxies to microbes. If you want to understand the physical world, you follow the energy.

The energy balance sheets seem to contradict the idea that we have a crisis of power generation. Quite the contrary; they indicate a massive glut. That in itself raises other questions. For example, how has this glut of cheap energy distorted our economy? How will the end of this glut change our economy?

I'm not an economist, and I don't want to be one. In any event, following the energy leads to other more interesting questions. How has the flow of energy shaped us? A photon strays into the waiting chloroplast, ultimately making a sugar molecule. The molecule becomes part of the meal of a gazelle. The gazelle and a hunter sprint together through a blazing sunset over the Rift Valley a hundred millennia ago. We owe our existence to a wrinkle in the ledger books of the planetary energy accountancy. How does that work?

Things are looking up.

I was biking to the gym yesterday, and it occured to me that since it was so beautiful outside, I may as well just keep biking. So, instead of sitting on the stationary bike, I did a three and a half hour ride down some random county road. It was awesome, even with my funny little commuter bike.

Along the way I passed this pathway planted with olive trees through the middle of one of the UC Davis research farms.

Note to self: Plant more olive trees.

This quarter, I'm taking :

• Mathematical Methods : Laplace transforms, Fourier transforms, Greens functions, and their applications to partial differential equations.
• Quantum Mechanics: Again. For the heck of it.
• Numerical Methods: Analysis of the performance, stability and error propagation of numerical algorithms in finite precision systems.

So far, it's way more fun than last quarter. Still, I'm disappointed that the molecular structures course I wanted to take conflicts with numerical methods. Hopefully I can take it next quarter.

The preliminary exam for mathematical methods is in the middle of finals week at the end of this quarter. That is going to suck.

As I mentioned in the previous post, I saw an awful lot of houses. Some of them made me a little jealous, and others made my skin crawl. All of them got me thinking about the housing crisis.

While the housing bubble was in full swing, I had a very strong intuitive reaction to house prices; everywhere I looked, I saw prices that felt two to ten times too high. As it turns out, my intuition was right. Houses that were worth something were vastly overvalued, and there were an awful lot of houses that simply should not have been built at all. The latter was usually due to a combination of uninspired design, remote location, and natural hazards. Again, it turned out that I was right. (I don't claim exclusive clairvoyance here. Lots of people felt the same way.)

There are many things that helped create this situation. The answer the idiot-media has been pushing is that subprime loans flooded the market with money by giving loans to people who didn't qualify. The flood of cash drove up prices, which are now coming down. Leverage is definitely part of the problem, but the subprime aspect is overblown and widely misunderstood.

The fundamental problem is that there simply isn't enough affordable housing. People need homes, and there are good financial reasons why people want to own their homes. If home prices are out of reach, then of course people will abuse leverage whenever it is available. The market simply isn't supplying enough affordable housing.

Why not? The simple answer is the conflict of geography and geometry.

There are two categories of factors that contribute to the value of a home; the home itself, and the resources that can be tapped from the home. The resources available from the house provide options to the homeowner; more options mean better quality of life. More options also mean that a particular house could satisfy the needs of a greater number of potential owners, giving it more resale value. History has proved again and again that the second category is vastly more important than the first. Hence the expression, "location, location, location." This is why airless, vermin-infested closet space in Manhattan sells for millions of dollars while palatial estates in Riverside can be had for less than a tenth as much. It goes without saying that the owner of the airless Manhattan flat has access to more resources, and resources of higher quality, than the owner of the ranch in Riverside. That is the geographical aspect of the problem.

The geometry aspect comes into play when you consider how structures are distributed and how resources are made available in these structures. The Earth provides an approximately two-dimensional plane (actually, modern economic and military history can be viewed as a consequence of the increasing importance of the Earth's spherical geometry, but right now I'm thinking of more local effects -- read, for example, the chapter "Global Midway" in War and Remembrance to get a sense of what I mean). Resources available from a particular location scale like the square of the density of resources within the distance accessible from that point. As the density increases, people will start building upwards (sky scrapers) and downwards (excavation). This introduces a volumetric effect, causing the available options to scale like the cube of the local density of resources. As density continues to increase, it becomes financially viable to build mass transit, which extends the radius of practically available options. This introduces a quartic scaling. As the density increases further, it becomes necessary to seek synergies and greater efficiency to minimize use of space. This introduces a scaling at the fifth power of density.

So, as the density of a settlement increases, geometry militates the use of ever more potent means to reduce the footprint of an available resource, which in turn facilitates greater density. Each new means of increasing density adds an additional linear scaling, so that the ultimate scaling is approximately

Of course, a polynomial of infinite order is the Taylor expansion of the exponential function. So, we can claim that the approximate value of a home scales exponentially with the density of resources in that area. The first three terms are required by simple geometry, and higher terms increasingly represent technological and social responses.

Really, this is the lower bound on the value; the value of a home also depends on how many other people might want it. If people select a home mostly for the choices it makes available to them, and each person has a different collection of choices they want, then there is some kind of combinatorial scaling as well (I'll leave this one as an exercise; you can get several different scalings depending on the assumptions you make).

Meanwhile, the value of the house itself scales linearly with the cost of the stuff you put into building it (labor and materials). However, nicer houses tend to be larger, and thus neighborhoods of big houses tend to be sparse. Thus, if the value of a home is the sum of the value of its location and its embodied value, embodied value will inevitably be overwhelmed by the locational value. This is a classical Malthusian conflict, but in this case the functions represent different things.

So, why the crisis? Well, we have artificially capped the growth of density. Zoning laws forbid the construction of new Manhattans, and require the gradual erosion of existing high-density neighborhoods as their buildings wear out and need to be renovated or replaced.

This is the story we tell each other about how this happened; the automobile gave people greater mobility, allowing them to live in the suburbs and countryside while they still work in the city. So, there was a great exodus from city centers to suburbia. This narrative has things exactly backwards. Density at the city periphery was legally capped and aggressively driven down, which forced people into the suburbs to seek affordable houses, making automobiles necessary to access resources that were previously available on foot. The first story is a marketing pitch, the second is recorded history.

In the early post-war period, opinion surveys consistently showed that the top transportation issue on the minds of Americans was the improvement of streetcar service, and the top housing issue was the rapid inflation of rent and other prices in city centers after the wartime price controls were lifted. People did not particularly want cars and suburban bungalows; they simply made a rational choice in the face of exploding rent and decaying public transportation. Even so, suburbia remained relatively unattractive for most people until Brown vs. Board of Education in 1954, and picked up steam in the early 1960s when racial tensions transformed the suburban exodus from an economic issue into a racial one. See, for example, the abandonment of Detroit, or white flight from Los Angeles to Orange County. That is the story of suburbia.

There is one more geometric factor to consider regarding the value of a house. The cheapest possible thing to add to a house is square footage. The "core" of the house -- the appliances, utilities, cabinetwork and main structural elements -- represent the bulk of the cost of home construction. Big houses are worth less, on a per-area basis, than small ones.

For the last 50 years, we've been building increasingly sparse neighborhoods of increasingly big houses. In real terms, the cost of ownership has gone up dramatically (heating, cooling, lighting, transportation, maintenance, taxes), while the real value of our houses and neighborhoods has decreased. Both of these scalings are exponential in nature; a modest increase in square footage translates into an exponential reduction in value per square foot.

In 1950, the average American home was 983 square feet. In 2004, it was 2349 square feet. In the neighborhoods most impacted by the building frenzy from 2004 to 2007, it almost doubled again, to around 4000 square feet for new construction. We're talking about a quadrupling of home sizes in 50 years!

Bigger homes require more land, and so density of resources available from these places must scale inversely with the square of home size -- and by the reverse of the argument above, decreasing density introduces higher order scalings whose sum produces an negative exponential effect. So, as homes increase in size, their value will exponentially approach the cost of the raw materials that went into them, until at some point the value falls beneath the associated costs, and owning one becomes a net liability.

The benefits and costs of owning a particular home are tied to labor market conditions, commodity prices, nearby development, and many other things. Thus, the narrower the margin between the benefits and the costs, the more likely the normal fluctuations of the economy will land you with a net liability. Adding leverage into the mix just makes the margins even narrower.

There is the nub of the issue. "Affordable" doesn't mean low price; it means getting a lot of value for a given cost (I am using the terms 'value' and 'cost' in a concrete sense, so you may substitute 'enjoyment' and 'effort' if you like). It means having a comfortable margin between the benefits of home ownership and its associated costs. It means a margin that is wide enough to absorb the risks we face in the event that they become realities. It means that you can still pay your bills if gas prices go up, or if you get a new job, or whatever. This lack of affordable housing doesn't just hurt poor people, it hurts all home buyers. We have a huge glut of houses that have virtually no value in them it all, except maybe as firewood, and almost no available houses with a decent number of readily available resources.

This isn't a situation we can bounce back from through financial mumbo-jumbo. The problem is intrinsic to our built infrastructure. The solution requires physical changes to our landscape. It will take a long time. Much hay has been made about the culpability of Wall Street in this crisis, usually portraying "Main Street" as the innocent victim. This is bullshit. Main Street is just as culpable, and maybe more so. Solving this crisis will require re-writing building codes and zoning laws, not just baking regulations. The crisis will ease up when we have enough compact, high-quality homes in good neighborhoods. By "enough," I mean we have to keep building them until the prices for these places puts them within reach of households at or below the median income.

It really doesn't help that our cultural prejudices insist on equating square footage with value; it is a false economy. Square footage is the high-fructose corn syrup of our financial system; cheap to produce, tragically unhealthy, and no matter how much you have, it never satisfies.

After almost fifty-some hours riding the train, I have a few impressions worth sharing. I had a lot of time to think, and a lot of things to think about, so I'm going to break this up into a couple of posts.

I expected to get a great deal of work done in that time, and I accomplished absolutely none of it. Not a single jot. I basically spent the whole trip either looking out the window, or happily asleep. There is just too much to look at; breathtaking snow-capped mountains too numerous to name, scores of towns and a dozen cities, the vast arid emptiness of New Mexico, lonely volcanic prominences rising from Euclidean flatness, knots of green trees rioting in pocket valleys bracketed by sterile sun-blasted volcanic rocks, and the profane, hideous pointlessness of Texas cities.

The trip was a grand tour of the majestic beauty of our country, and an industrial colonoscopy showcasing a great deal of what is wrong and twisted about its economy.

I will spare you my gasping about mountains and trees. I lack the skill with words necessary to even crudely sketch such things. You simply have to see it. Instead, I'll tell you about the ugly and fascinating things I saw. They leave me truly awed.

The first thing that struck me was the vast and penetrating impact of exurban development.

It was heartbreaking to see just how much of the land is already destroyed. In California, luxury homes and golf courses fill every level patch of ground from the outskirts of incorporated Los Angeles to Palm Springs. Tuscon and Phoenix have similar, lower-budget penumbras of sprawling exurbs stretching two hundred miles in every direction. In the space between the outskirts of Palm Springs and the outskirts of Tuscon, people are busily making preparations to link these two cities with a continuous smear of houses. I was relieved to notice that many developments in the margins seem to be abandoned. One of them was nothing but rain-swelled chip-board and wind-tattered Tyvek nailed to dozens of identical frames. I regret that the photos didn't turn out.

That isn't to say that I don't have sympathy for the lives and fortunes that are suffering as a result of the economic pestilence that ruined these ventures, especially the craftsmen and laborers. But the fact is, nobody should be building out there. America's natural spaces should be treated like places of worship. Look at these houses huddling at the foot of this mountain:

These are money changers in the temple. I'm not against money changers in general, but they shouldn't ply their trade in my temple. Actually, this is quite a bit worse than the New Testament parable. The money changers could be thrown out and the sacred space restored. After the developers are thrown out, millions of their innocent dupes remain.

As beautiful as it is, this land is both exquisitely fragile and damn miserable to live on. Fragile because there is so little water, and miserable for its looming and contrarian propensity for devastating floods. Fragile because of the trophic poverty of the nutrient-starved ecosystem, and miserable for its tendency to erupt in sudden racing conflagration. Fragile because of the extreme sensitivity of the wildlife to disturbance -- a few scattered bottle caps have likely doomed the recovery of the California condor -- and miserable for the tendency of the wildlife to apply claws and fangs and venom to pets and loved ones. Fragile for the delicate balance of commodity prices and labor market conditions that make inhabitation possible, and miserable for the stress and strain of living on the knife's edge of financial viability, and doubly miserable when the distant rumbling of our global economic system brings your financial house crashing down on your head.

The only way most people can be comfortable in this kind of place is to obliterate it. Suck dry the aquifers, poison coyotes, shoot the mountain lions and the red-tail hawks, pave the chaparral, relocate factories and office buildings and depots from the distant city, blast and grade the mountainsides for drainage ditches and flood control swails, murder the night with the eyewatering glare of sodium vapor floodlamps. Then what have you got? Just another hot, boring place.

Yes, we can inhabit these places. Such is human ingenuity and power that given sufficient amounts of dynamite, concrete, oil and steel, we can probably live anywhere we can reach. We can blast and pave and bulldoze and burn any landscape to suit our purposes. The great challenge of the 19th and early 20th was to learn how to do these things on the scale required by the lethally difficult lands of the American West. A hundred years ago, life in the Mojave desert was so hardscrabble that few of even the most intrepid adventurers bothered to attempt it. Today, we build full-scale replicas of Scottish seascapes on which we play golf.

The great challenge of the centuries to come will be to abstain from exercising this power, and instead develop better enterprises in which to invest our blood and treasure.

Since I've been telling anyone who'll listen for the last couple of years that we've got to use trains for travel more often, I decided that I should take my own advice. I'm going to visit my little sister in Oklahoma, so I'm taking Amtrak there from Los Angeles. I'm taking the Texas Eagle to Fort Worth, and then the Heartland Flyer to Norman, Oklahoma.

It's going to be a long trip (about two days). It could be a lot shorter, but we've been letting our passenger rail service rot for sixty years. I'll post pictures from the trip when I get to Norman, and sooner if I can snipe some WiFi along the way. Until I do, here is a picture of the Capital Corridor train rolling into Davis.

I just got the email from AIP a few hours ago; my first paper as first author is published!

It was a surprisingly long process. I think most of the delays were due to my own lack of experience. Hopefully, they are lessons learned, and my next trip through the publishing gauntlet will be easier, faster, and hopefully even more fun.

My uncle asked me if I would try to explain what I did in simple terms, so here it goes.

There is a thingy called a tokamak that is basically a very fancy Thermos. It keeps hot things hot. If you can make the stuff inside hot enough, it will work like a nuclear reactor. This is interesting because it is possible to build much better, much safer nuclear reactors this way. The trouble is, these Thermos things cost billions of dollars. The one they are building in France is going to cost something like nine billion bucks, and it will get barely hot enough enough to work as an experiment. Real ones would cost even more.

The good news is that the current designs for these fancy bottles only use a few percent of their heat-trapping capacity. That's what 'beta' means in the title; you can think of it as the heat-trapping efficiency of the machine. This is different from the energy efficiency, though. The heat trapping efficiency is more like how full you can fill the Thermos. Right now, we are building a nine billion dollar Thermos, and only filling it to 2% of its theoretical capacity. If we could use more of the heat-trapping capacity, then you could maybe reduce the cost by a factor of ten or a hundred (or increase the performance by that much).

So, this line of research is all about computer simulations of these doughnut-shaped nuclear Thermoses, and how they behave when they are nearly full.

In some other papers, I helped show that it is likely possible to build a nuclear Thermos that you can fill almost all the way up. In another paper, I also helped my friend Pierre show that it is possible to start with a nearly empty Thermos, and fill it to nearly full without anything bad happening (it all comes down to how you pour, to stretch the metaphor).

Typically, you have a theory that you trust, and you want to know if your computer simulation matches the theory. In this case, however, we built a computer simulation that contained very few assumptions. It solves Maxwell's equations (for magnetic fields and currents) and Newton's equations (for moving masses). This is nice, because those equations have been tested really, really well over the last 130 years. It also means that you can take the output of the computer program, and very easily check to see if it is correct.

As a result, we had the opposite problem one normally faces in science; a computer program that we trusted, and a theory that maybe we didn't. In this paper, I used the computer program to validate that the theory was correct. I did this in an unusual way. The theory is approximate, and so we expected it to go funny in some places. I treated the computer-generated output as the "exact" solution, and showed that when you subtract the theoretical result from the result we got from the computer, the difference is precisely the amount by which we expected the theoretical result to go funny. (In more rigorous language, I proved that the deviation from the numerical result has the same scaling as the error term in the expansion.)

Here is a link to the paper, in case you don't have access to AIP.

It was a nice day today, so I decided to walk around for a few minutes and take some photos. It was a nice break from studying for finals. I thought this was an interesting juxtaposition.

The arch of an open boxcar I saw today...

...and the Arch of Constantine

What do you think?

One of my favorite bloggers died on Sunday. I didn't know anything about her personal life until today. She was fighting ovarian cancer with a poor prognosis, and died at 47. Her obit is in the New York Times.

She was probably the clearest, most readable and best informed voice on the mortgage crisis, period. She was also pretty much the only person who had anything positive or funny to say about it. Or, at least she set mood for the general commentary at "dry wit," when it easily could have been "catatonic depression."

From her platform as a co-blogger on Calculated Risk, she wowed people from Nobel laureates to analysts at the Federal Reserve. Pretty much everything I know about the details of the mortgage crisis I either know because she explained it to me, or because she explained it to someone else I read (e.g., certain Nobel laureate economists).

She had hoped to return to mortgage banking after the crisis and after recovering from cancer, but she made such a mark with her writing over the last two years that most people doubt that would have been possible.

One thing that makes big media so stupid is that they always turn to the same stable of pundits for commentary on complex issues. Unfortunately, most of these guys are not very bright and not very informed. But there is a solution. For every issue, even issues as murky and choked with dull tedium as the mortgage banking industry, there are people like Tanta. She was an expert straight from the trenches, but with a view broader than anyone could see from the ivory towers of academia or the skyscraper corner offices of industry. She was exactly the sort of person that major media outlets should recruit for beat reporting. The murkier the issue, the brighter such people can shine.

Alas, this particular glimmer in the gloom has gone out.

This morning my dad sent me a New York Times op-ed by Dan Ariely, a professor of behavioral economics at Duke, on the total idiocy that is executive bonus pay. Here's the main bit :

Of course, there are many reasons to be disgusted with executive pay. It feels unfair that so many people make so much money managing our money, and it is often difficult to see how their talent and abilities justify their compensation. We find it particularly offensive when executives receive high bonuses after disastrous performances. But doesn't the promise of a big bonus push people to work to the best of their ability?

To look at this question, three colleagues and I conducted an experiment. We presented 87 participants with an array of tasks that demanded attention, memory, concentration and creativity. We asked them, for instance, to fit pieces of metal puzzle into a plastic frame, to play a memory game that required them to reproduce a string of numbers and to throw tennis balls at a target. We promised them payment if they performed the tasks exceptionally well. About a third of the subjects were told they'd be given a small bonus, another third were promised a medium-level bonus, and the last third could earn a high bonus.

We did this study in India, where the cost of living is relatively low so that we could pay people amounts that were substantial to them but still within our research budget. The lowest bonus was 50 cents — equivalent to what participants could receive for a day's work in rural India. The middle-level bonus was $5, or about two weeks' pay, and the highest bonus was $50, five months' pay.

What would you expect the results to be? When we posed this question to a group of business students, they said they expected performance to improve with the amount of the reward. But this was not what we found. The people offered medium bonuses performed no better, or worse, than those offered low bonuses. But what was most interesting was that the group offered the biggest bonus did worse than the other two groups across all the tasks.

My dad asked, "Surprised?"

Nope. Not surprised at all.

The whole theory of executive pay is based on a slightly different idea than motivation. Boards are not exactly trying to motivate their executives to perform, they are trying to attract what are invariably described as "the highest caliber" candidates. It works if you assume that ability is some kind intrinsic property of humans, and that if you dangle a big reward in front of a big group of people, the most able ones will triumph and seize the prize. It's naked social Darwinism. That's what people mean when they talk about people's "caliber," or whatever. It's sloppy thinking, and sloppy thinking usually gets the sloppy thinker into trouble. A gigantic, world-girding economic catastrophe, for example.

I think bonuses fail for an even simpler reason than Dr. Ariely suggests: In a strictly scientific sense, there is no such thing as a smart person. There is no way to rank human beings based on cognitive skill in any meaningful way. In fact, it's not even clear we can define "cognitive skill." It's a 19th century idea that has been so thoroughly debunked that it has become a kind of parlor game for psychologists.

There are a lot of reasons for this, but chief among them is that we do not, in any substantive way, understand the nature of intelligence. We may think we know it when we see it, but we have no way of measuring it.

Tests of intelligence are actually on worse scientific footing than those people you see on TLC videotaping empty hallways through osmium-doped filters in the effort to prove the existence of ghosts. At least the ghost hunters are usually honest about their total lack of evidence, and at least there is some reasonable expectation that if there were ghosts, that you would would see them on the tapes. The College Board, and ETS, and pretty much every professor engaged in teaching that I've ever spoken with lack even the intellectual honesty of crackpot ghost hunters.

Clearly, there is variation among people when it comes to performance of specific tasks. Some people are really good at memorizing sequences of numbers and repeating them back in some carefully jumbled order. This is usually taken as an indicator of mathematical ability. Nevertheless, I find that I cannot memorize sequences of numbers to save my life, but that doesn't stop me from doing quantum mechanics.

So, once we've measured everyone's performance on the regurgitating-numbers-test, and put everything in a big table and sorted the table by score, what have we learned? Well, not very much. We might be able to draw some conclusions about people in general, perhaps, by correlating performance on the test with choice of breakfast cereal, or whatever. But it doesn't tell you anything of significance about an individual test subject.

However, it is usually possible to tell a smart idea from a dumb one. Unlike people, ideas can be subjected to detailed analysis. They can be examined for internal logical correctness. They can be modeled by equations, or simulated, or tested empirically, or compared to historical data for similar situations and the results considered. They can be slotted into a multiplying zoology of ready-made intellectual frameworks, and poked and prodded and stretched and tortured in all sorts of interesting ways. They can be placed head-to-head with other ideas in the analysis gauntlet, and in many cases it is possible to pick winners, or at least to triage pretty good ideas from dumb ones.

It's more work to pick smart ideas ideas than to pick smart people because the techniques we have for picking smart people are a fraudulent mummery that can be conducted with hardly any work at all. And lo, we see that systems in which ideas compete work very well (e.g., science), and systems in which people compete are either totally artificial (e.g., sports) or tend to function worse than had you picked the players at random (e.g., business, politics).

If you dangle a big reward in front of a big group of people, all you really know about the person who seizes the reward is that you have found someone who is good at taking large amounts of money from people. If I were looking for someone to run my company, I would be suspicious of such a person.

There were a lot of remarkable things about Obama's campaign, but one of the most significant aspects is that it was funded by millions of ordinary people who could only muster small donations. I've been thinking a lot about how that model could be turned bigger problems. Here's what I've come up with so far.

Most people set aside part of each paycheck for a variety of things. 6.2% of each paycheck (up to $102,000) pays for contributions to Social Security, 1.45% goes to Medicare. Then there is income tax withholding, contributions to 401k plans, health plan co-payments, and so on. I think we should create an additional voluntary withholding item with a variable rate that would feed into a fund that invests in revenue generating national infrastructure.

The idea is to offer taxpayers an investment option with a risk profile somewhere between Social Security (which is designed to be a sure thing) and a 401k (which can be lost completely). Contributions would be invested only in critical national infrastructure projects, like transport and renewable energy. The investments would be structured so that they would pay dividends. For example, the fund could build wind turbines, and the dividends would come from the electricity revenue.

This would help solve three problems :

• It would give taxpayers a relatively safe investment option. The dividends might fluctuate from year to year, but the investment could never be lost. This would provide a nice compliment Social Security and a 401k.
• It would create a pool of money designated for projects of crucial national importance. The fund would be big enough that it could invest on a scale impossible for private equity. Also, the focus on generating long-term reliable revenue instead of capital gains would allow the fund to invest on a much longer time horizon than most private equity.
• It would bring patriotism, volunteerism and ecological-mindedness into alignment with individual financial self-interest.

I suppose similar things exist in the private sector already, mainly in the form of green mutual funds and suchlike. I've never been very impressed with them. Mutual mostly seem to focus on capital gains, which seems like a crummy way of monetizing basic infrastructure like electrical generating capacity. These funds are also generally very small, which means they cannot invest directly in projects and they have high overhead expenses.

I'm not interested in yet another speculative investment option. The private sector does a good job there, and doesn't need to be duplicated. I'm thinking of a different sort of model, more like social entrepreneurism, but with mass-participation.

A lot of people fought long and hard to give me the right to a secret ballot. This time around, though, I'm happy to show it to anyone who cares to look.

I like this ballot system much better than the InkaVote thing they have in LA, and much better than any kind of computerized bullshit. I spent four years using computers to design fusion reactors, but I sure as hell don't trust them with an election. Pen and paper, thanks.

Normally, I really, really hate mornings. When my radio clicked on this monring, it was in the middle of a country song. The first lyric that came up was, "I'm so tired of Mr. Wrong, I'm gonna find me a Mr. Right." That was the first time I've woken up laughing in years.

I'm going to fix myself a nice steaming cup of democracy.

I propose a ballot initiative to amend California's constitution to end ballot initiatives. Who's with me?

I like the idea of a little direct democracy, but it if I'm going to be expected to cast votes on these damn things all the time, then I want my damn legislator's salary. The initiative process should be reserved for extremely serious problems, like succeeding from the union if the Republic gets overthrown by evil blob aliens, or whatever.

What should be proposed, exactly? What if initiatives needed to pass at 66 percent? Or maybe if we required that a third of all California voters sign the petition to get it certified? How do we get rid of these damn things?

Continuing on yesterday's theme, here is another thing that is stupid: Tax cuts. Now, I don't especially like paying taxes, but if given the choice, I'd take a raise over a tax cut any day. A pay raise for me means that not only am I wealthier, but everyone is wealthier. A tax cut means I'm getting a little wealthier at the expense of others.

But that's just my personal preference. Others may feel differently. However, there is another very simple economic reason why tax breaks are a stupid way of encouraging businesses, especially new industries. As Todd Woody writes, if you give a generous tax break to a small company, it often doesn't have the income to take advantage of the incentive. So, it has to form a tax equity partnership with another company that can use the tax break. With the credit markets screwed up, and Wall Street burning equity like books at Bebelplatz, it's gotten pretty damn hard to put together tax equity partnerships. Not to mention that if you are big company taking large losses, your writeoffs probably provide all the tax relief you need.

Under good conditions, the senior partner in the tax equity partnership often stands to gain a lot more than the junior partner, and the incentives end up helping the wrong people. Under current conditions, few companies are lucky enough to actually need a tax equity partnership with a scrappy little solar company with big plans. End result: a lot of those tax breaks are worthless to the people they are intended to help. Worse still, the more urgently the help is needed (like when the economy stinks), the more useless the tax breaks become.

So, enough with the tax breaks. They are stupid. If the government wants to help establish a new industry, as it did with semiconductors, the internet, and electricity, there are much more sensible options. For example :

• Invest directly, especially in R&D.
• Establish public trust funds to take equity positions in promising companies.
• Agree to buy the product at a predictable price.

That last one is probably the most important right now. The federal government is huge. When it makes significant purchases, it is big enough to jumpstart whole industries. That is how the semiconductor industry got off the ground. If Congress wants to get the solar, wind and geothermal industries rolling, it should simply agree to buy all the electricity they can make, and to hell with tax incentives.

While I'm greatful that Peet's Coffee and Tea provides Wifi for people who buy coffee from them, I think their censorship software is very, very stupid. Take this salacious image, for example :

SonicWALL brilliantly flags this as 'Pornography.'

Seriously. This is a huge waste of everyone's time and money just to make sure nobody sees any boobies.

I was wondering how we'll know when the credit crisis is over, and I thought I'd share my gloomyness with you, dear readers.

The Big Money people invested vast amounts of capital in malls and condominiums, and now they have to come to terms with the fact that these things are not productive assets. All of that capital was blown on green lawns and shiny baubles, instead of invested in equipment and training. Now the capital is gone, with nothing to show for it but a bunch of luxury stucco boxes in the desert with no schools, no jobs and no water rights.

You'll know we're near the end of it when they start bulldozing abandoned subdivisions and planned communities. That's the reality of the situation; we built too much housing, we built housing of the wrong type, at the wrong size and scale, with the wrong materials and the wrong technologies, and we built it in the wrong places. Until Americans face that reality, the financial system will stay broken. But once the bulldozers get to work, you can be pretty sure that the reckoning is underway, and the stock prices you see are close to honest.

The metric for recovery that I'm keeping in my head is this; when it becomes profitable in Southern California to buy up a bunch of crappy houses, tear them down, plant some orange trees, and sell the oranges, then we're good.

A few days ago, the new Django 1.0 packages got installed on our colo machine. Evidently, the Django people decided to break a whole ton of stuff. It took me a couple of days of desperate hacking to get the site up and running again before classes started.

Bad Django. No cookie.

So, it looks like once again, the Democrats are letting themselves get stampeded into yet another colossal Whitehouse-hyped fiasco. Everyone is so very impressed with Henry Paulson and Ben Bernanke, and their wonderful credentials, that they're willing to take their bullshit at face value. Remember Colin Powel's photos of Iraqi mobile weapons labs? Remember the incredible haste with with which Congress was forced to ram through amnesty for treasonous telecommunication companies? Remember the $300 billion we blew on the Economic Stimulus Act of 2008? Like most Americans, I sent most of mine to the Saudis. Pfft.

I am continuously astonished by the ability of conservatives to refuse to, you know, conserve. When difficult times come along, there is somehow always a refusal to prioritize and make sacrifices. That doesn't make the difficult times go away, so instead we end up sacrificing important things instead of unimportant things. For example, when it was clear a few months ago that consumer spending was flagging, it was decided that putting a few extra dollars in the people's pockets would help.

What did Congress do, at the urging of the Whitehouse? It borrowed the money. If that were the only way to put a few hundred bucks in people's pockets, then so be it. But it wasn't. One of the things that was taking money out of people's pockets was the spike in gasoline prices. Push prices down, and everyone who uses gasoline would be that much richer. What's the simplest way to reduce gas prices? Why, to use less of it, of course. What's the simplest way to do that? Impose a speed limit. Duh.

A conservative financial decision would have been to lay it out to the American people this way: We can either borrow the money to give to you, and then make you pay for it with higher debt maintenance payments and higher taxes, or we can impose a 55 MPH speed limit for 200 days. Now, driving 55 sucks, but don't you think it'd be worth it to avoid running up the debt? Don't you think it'd be worth it for lower prices and a little extra money in your pocket every week?

But no! Driving huge vehicles far, fast and for no reason is the American Way of Life! It's evidently more important to protect the sanctity of the gas pedal than to safeguard the solvency of our republic.

When it rains, it pours! I've been hanging around all summer wondering what to do with myself, and now suddenly there is a huge explosion of activity. After a four day expedition to Davis to sign paperwork at Graduate Studies, register for classes, look for a job, look for an apartment, and get a sense of what it will be like to live here, I drove back to Los Angeles for my cousin Nathalie's wedding (Sunday) and my great aunt's 88th birthday (Monday). Both were beautiful. Then I packed my car and drove back to Davis this afternoon.

Tomorrow, I have a job interview and tour for an on-campus job working in one of the Department of Entomology greenhouses. Not quite as good as a TA position, but it would pay for rent and get me outside and moving around on a regular basis.

I still haven't found a place to live yet, but a very nice fellow from my department is letting me crash on his living room floor until I do. Classes were supposed to start Thursday, but evidently the professor for that course isn't here yet.

The student affairs officer at UC Davis said that there are possibly some TA fellowships still available from other departments. I want to make sure I get one, so I'm jumping in my car and driving to up to Davis with a couple of crumpled bills in my pocket, a shopping bag of canned soup, and an empty bank account.

Ah, adventure! I'll try not to get E. coli poisoning this time.

It looks like the New York Times was seriously shocked by Sunday's news. So shocked, it seems, that that they left grammatical errors all over their headline story about Lehman Brothers :

A.I.G. will be the next test. Ratings agencies threatened to downgrade A.I.G.’s credit rating if it does not raise $40 billion by Monday morning, a step that would crippled the company. A.I.G. had hoped to shore itself up, in party by selling certain businesses, but potential bidders, including the private investment firms Kohlberg Kravis Roberts and TPG, withdrew at the last minute because the government refused to provide a financial guarantee for the purchase. A.I.G. rejected an offer by another investor, J. C. Flowers & Company.

I think the copy editors must have been on the phone to their brokers.

Evidently I'm going to graduate school. I'm just not yet sure where, or what I shall study. Decisions, decisions.

My first attempt at sourdough bread seems to have produced a pair of unexpectedly tasty results. I was rather skeptical that this would actually work the first time. The taste came out much better than I had hoped for; awesome sourness, but not so sour as to overpower the flavor of the wheat. These are 50% whole grain, so they have some nice texture from the bran, but are still chewy and moist.

The boules didn't quite shape up the way I wanted them to, and sort of spread out on the baking pan once they came out of the bannetons. That's why they're more disk-shaped than sphere-shaped. Also, I didn't attempt anything fancy with the crust.

I cultured the starter from stone milled rye flour, and fed it alternating whole wheat and white flour every 12 hours for two weeks. The starter was the only difficult part. I killed my first starter by accidentally overheating it in my makeshift incubation pan. I gave up on the precise temperature control, which seems to have produced a somewhat less lively starter. It lifts the dough just fine, though.

The ingredients were :

• 1/4 cup starter
• 3 cup whole wheat flour
• 3 1/2 cups white bread flour
• 2 1/2 cups water
• 2 tsp salt

I know it's better to use grams than cups for measuring flour, but I don't have a good bench scale yet.

This made two loafs, which I put into bannetons for 12 hours of rising. I baked them for 45 minutes at 375F, with a pan of water bubbling away at the bottom of the oven.

I made the bannetons from some small fruit baskets that were sitting around attracting junk accumulation. I made the liners by reclaiming some nice raw linen that was part of an IKEA laundry basket that had fallen apart at the seams (carefully washed, of course). I floured the banneton liners carefully, so they didn't stick much at all.

I thought the whole point of nominating John McCain was that he was supposed to be the honerable candidate, and that he would take on the issues with the Democratic nominee. You remember the issues, right? Our assorted wars, our collapsing banking system, forclosures, the energy clusterfuck, torture, wiretapping, abortion, global warming, gay rights, taxes, the budget -- that stuff.

So, uh, when is he going to get into that stuff? He is seriously going to talk about Paris Hilton? WTF?

After taking a few days to think about it, I've decided to withdraw my endorsement for Barack Obama. I've removed the campaign logo and links from my site to indicate this decision.

To be clear, I do hope he wins, and I will vote for him. I hope he finds a way to win back my endorsement. However, I simply cannot actively support him after his vote on FISA.

Kudos to Obama for his artfully penned response to the gigantic groundswell of outrage, but this is something that leaves me profoundly disappointed. FISA was an unnecessary, rotten, law to begin with, and this law takes it from rotten to putrid.

Let me put it this way. Say you are an FBI agent, and you are working on a case. You think you need a wiretap ASAP. If you don't feel that the case is compelling enough to wake a judge up at 4 AM to get her to sign a warrant for your wiretap, then the agency probably shouldn't waste its time and resources pursuing the case.

The whole reason for requiring warrants to search and seize property is to focus law enforcement on compelling cases. The system is designed to weed out speculative and frivolous investigations, and investigations for improper purposes (political intimidation, for example). The administrative burdens placed on law enforcement are SUPPOSED to be burdensome. Sure, we should feel sympathy for the plodding investigator as he navigates through the red tape. But we should also recognize that the hassle he must undergo is a sort of administrative calisthenics. It makes for more thorough investigations, more accountable practices, and more successful prosecution.

If we want to help our hypothetical plodding investigator, we shouldn't make his job simpler. We should give him more material resources. Worried about not getting warrants quickly enough? How about expanded staffing to process warrants? Better IT infrastructure to handle the process faster and more efficiently? Or heck, why not just set aside office space for judges nearby the operations center? Processing warrants is one of the key duties of serving on the bench, and in my experience, judges generally take all parts of their jobs very seriously.

Even if we grant, for a moment, the ridiculous "ticking bomb" scenario that seems to motivate all conservative thinking on domestic security, special legal "tools" like FISA are still totally unnecessary. Terrorism cases are not unique in the urgency with which they must be pursued, or in the scope they must cover, or in the potential number of victims. Ordinary homicide investigations can be just as urgent; racketeering and organized crime cases can be just as broad in scope; environmental cases can involve just as many victims. Terrorism is unique only in the sense that it can potentially combine these aspects. Terrorism cases are bound to be complex and difficult, but the difficulties have nothing to do with complying with appropriate judicial oversight. Any competent homicide detective knows how to obtain a warrant when she needs one in a big hurry. The FBI organized crime people know how to obtain warrants for complex investigations. Investigators who handle environmental cases often use the potential for mass casualties to obtain authorization to conduct wide-ranging investigations. Terrorism investigators need to do all those things at once, and so they need low caseloads, a lot of very competent support staff and a well-run computer network.

As with any other class of investigation, we should not expect better results by relaxing judicial oversight, or in the case of the new FISA law, no oversight whatsoever. Quite the contrary. Exception from the fourth amendment allows more latitude for sloppy work, but won't help an honest cop catch any bad guys. What conservatives are really asking for when they rail against judicial oversight is that they don't want honest cops; they want Gestapo.

Naturally, conservatives don't want the EPA or the Forrest Service to have expanded investigative or enforcement powers. Extra-constitutional intrusions into the private lives of Americans are evidently reserved for manly things. For girly things, like protecting spotted owls from logging companies and children from arsenic poisoning, conservatives never fail to come out in favor of judicial micromanagement. This works in concert with their habit of appointing industry lobbyists to the judiciary.

What angers me about Obama's position (and the Democratic leadership) here is that they conceded a fundamental philosophical point to the GOP. They are granting that security theater is more important than the law. Not only that, but in the same stroke, they endorsed the criminal behavior of the people involved in what is probably the largest and most serious breach of the fourth amendment in our history. I cannot abide it.

I will vote for Barack Obama, but I'm not going to endorse him, or give him any more money. Instead, I encourage you to contribute to the Electronic Frontier Foundation.

The contractors installed the last row of panels this morning and switched on our solar array. Our house now produces about 15% more electricity than it uses!

The array produces between one and three kilowatt-hours for every hour of sunlight, so for today's half-day of production, we've generated 13 kwh.

Here's the read-out on the inverter :

Sadly, I don't have a way of getting the data out of the inverter yet. Once I add the RS-232 module, I'll have have more interesting things to say about our system. I'll post some pictures of the array itself once we've passed inspection.

The Sunny Boy inverter has an interesting user interface. There aren't any buttons -- you interact with the display by knocking on the front panel with your knuckle.

A friendly reminder to those who are following the nomination process: Party primaries are not national elections. Political parties are essentially private clubs. Subject to a few basic limitations (e.g., Brown v. Board of Education), they can make up whatever rules they like. If the Democratic Party wants to select the presidential nominee via a dance-off, or a hip-hop battle, or an egg toss, that is perfectly legal.

I keep reading about how the party isn't allowed to take away Florida and Michigan's delegates. Of course they can; it's a private club. In fact, their rules stipulate that they must strip the delegates in this circumstance.

It's obvious to everyone that the nomination process isn't perfectly equitable, but the system we have now is a huge improvement over the smoke-filled-room method of the very recent past. Hillary Clinton has raised some important objections to how the system works. That's good. It needs improvement. However, winning the nomination and fixing the nominating system should not be conflated. This is her party, after all. She's been extremely influential in the party for almost sixteen years. If she wants to advocate for reforming the process, then she was welcome to spend some of those sixteen years of influence, you know, influencing. After the election is over, if she uses her influence to push for reform, that would be a great service to the party and to the nation. But pushing for reform in order to win isn't good for anyone.

I should point out that the general election system isn't exactly perfect either. Any competent candidate must demonstrate the technical abilities needed to campaign and win, fair and square, even in a system that is unfair and warped. I should also add that the Democratic nomination process and the general election process closely approximate a fair and equitable system, to a precision of a percent or thereabouts.

Elections are political instrumentation. They measure the prefrences of large groups of people. Say, for example, that you take a measurement with a volt meter. It reads 5.13V, plus or minus 0.5%. It's not acceptable to write down 5.17V because you think the probe contacts are a little dirty, and that's throwing off the measurement. However good your intuition and experience, that's called fudging your numbers. If doesn't change the results, then a little fudging won't do much harm, even if it is bad methodology. If it does change the results, then it's fraud. Bad scientist. No tenure.

Our contractor, EE Solar, is about halfway finished with the solar installation at our house. Here is what they are installing :

• 14 SunPower 230 watt panels
• One SMA Sunny Boy 3000 inverter
• A second digital utility meter
• AC and DC disconnects with lockout-tagout switches.

The 14 panels will be arranged into two arrays with south-facing exposures producing 3220 watts of DC power. The inverter is about 95% efficient, so the nameplate capacity will be 2854 watts. The USGS indicates that we should get about seven to eight hours of usable sunlight per day on average. The array should produce an average of 17 to 20 kilowatt hours a day. This should easily cancel out our usage, and maybe a little beyond. I'm hoping for slightly better production, since Pasadena is higher and dryer than most of the LA basin.

Here is the equipment after delivery and upacking :

We were supposed to get a Sunny Beam monitoring station, but evidently there are some issues with buggy firmware, so they won't be available until September (more about that later).

So far, roof has been preped, the mounting rails are installed, the conduits are bolted in place, the DC wires are pulled, and the inverter has been bolted down. All that's left is to hang the panels, do the AC wiring, and get the inspection.

The installer crew was supposed to finish that on Friday, but evidently they decided to take the day off. The project manager at EE Solar pitched a fit. Nick, the crew boss, called on Friday to say he was really sorry. I told him that his schedule is his business, but if he can't come when he promised, he ought to let us know. On Moday, I'll ask him to run some extra conduit for ethernet to make amends.

In 1990, my family moved to Ohio. If you've ever talked to me about it, you know that I don't have many happy memories to relate about the experience. However, in Ohio, I gained a great friend.

Soon after we moved, my parents left for some sort of vacation. I don't remember where they went. My mother was taking classes at Wright State, and one of her classmates and her husband stayed at our house to keep my little sister (and me, I suppose) out of trouble. They brought their cat with them, who was not quite fully grown.

This was a very unusual cat. He was still a kitten, but he had none of the usual kitten hyperactivity. He was always utterly calm. He showed a keen interest in everything. He would peer down the sink drain intently, explore behind and underneath every piece of furniture, and sniff every plant in the garden. If you were eating something, he would wait patiently until he was allowed to examine it. Usually he didn't want to eat any, he just wanted to have a look and a sniff. He explored avidly, but carefully, methodically, and patiently. He had none of the aloofness or disdain that cats often show. His interest was genuine, but he just wasn't excitable.

He never made a sound. Not for any reason.

He was affectionate, but not attention-seeking. If you picked him up, he would purr, but he never bothered you for attention. When he wanted food, he would sit at his bowl and wait, patiently, and sometimes for hours.

My mother's friends felt bad keeping him in a small apartment, and they were going to move after they graduated. When my parents returned, they let us keep their cat. He was a beautiful orange tabby, and so they had named him Tigger. However, his personality had turned out so utterly un-Tiggerlike that we felt compelled to give him a new name. So, I named him Red Fred.

Fred grew into a massive, powerful cat. By the time he was five, he was a solid rectangular block of cat muscle, weighing perhaps eighteen pounds. He could easily have been the alpha cat, but he was uninterested. He left the alpha cat position to PVP (that name is another story), who was scrawny by comparison. Fred continued to patrol the neighborhood, evidently spending most of his time observing things. He would sit at the bottom of the driveway and watch people walking along the sidewalk for hours, or on fences staring into people's kitchens.

Whatever he did, there was a solemnness about it. He made you want to be quiet around him, so as not to disturb his observation and reflection.

When he hunted, he never bothered with birds or mice, and instead caught full-grown rabbits. As far as we know, he did not eat them. He would carefully carry them into the kitchen by the scruff of their necks, like kittens. He would then release them, and watch the resulting mayhem with interest. Some of the rabbits he caught were heavier than our other cats, and there was always a lot crashing about and shouting as we tried to expel them from the house.

He was also utterly trusting. One evening, he came to the door with a huge gash in his side, opening his flesh from his belly to his spine. He let my mother pick him up with just a small flinch. If you've ever had to work with an injured animal (or an injured person), you know how unusual that kind of self-control is. When she took him to the vet, he sat stoically on the examination table as they cleaned his wound and stitched him up. The vets were utterly astonished; there were three assistants in the room to hold him down, but they had nothing to do. They stood and watched as Fred bravely went under the needle, fully aware of what was happening. He still never made a sound.

Many years later, his friend PVP died. Thought his long life, PVP maintained a constant monotonous litany of hoarse, solemnly discordant meows. Fred found his body in the garden, and uttered his first sound. My mother came running to see what the strange noise was. After that, every few weeks, Fred hid himself alone in a closet or in the basement crawlspace, and imitated PVP's meow, eventually stretching it into a long, deep yowl. It was an eerie sound, much too deep, loud and extended than one would imagine could come out of a cat, or even a person. It sounded like he was on a PA system. He would do this for a few minutes, and then emerge from his hiding place as though nothing had happened. After that, this ritual became part of his life.

There are lots and lots of great stories about Fred, but they all share a common theme: Fred was a sage. I'd like to think that if there is such a thing as reincarnation, then he must have been a tulku, maybe taking one last look at the world.

On Tuesday, he had a stroke, and died without pain among people who love him. He was about nineteen years old.

For the first time, I just paid more than $4 a gallon for gasoline. It cost $40.34 to fill the tank on my tiny Toyota Yaris. My commute to UCLA is 37 miles each way, and I get about 38 MPG for that trip. I normally do a little better, but the Sepulveda Pass always seems to wreck my milage. At about $0.11 a mile, one trip costs me $7.77. If I drove in every day, it would cost me about $155 a month. That's almost as much as the payments on the car. If gas goes up another 84 cents, then I'd be paying more for the gasoline than the car just from driving to school.

Ouch.

Meanwhile, a Metro day pass costs $5, and a month pass is $62.00. If you commute in LA, chances are pretty good that your employer will buy your pass for you.

The Supreme Court of California has ruled that the ban on same-sex marriage is unconstitutional. Even the dissenting justices wrote that they support same-sex marriage -- they are of opinion that it isn't mandated by the California constitution.

Honestly, I was expecting it to go the other way.

Patt Morrison had a lawyer for the losing side on her show a few minutes ago, and he basically framed his position this way: Allowing same-sex couples to get married places personal choice above community standards. Allowing people to ignore community standards will erode the morality of our culture. That sounds like a pretty weird argument for a supposedly conservative point of view.

When it comes to something as private and personal as marriage, let community standards be damned. America's uniqueness flows from its protection of personal liberty, even when that means protecting things that you would not do yourself, or that make you feel uncomfortable when other people do them. I've visited the Harmonious Society, and I like it here better. A lot of blood has been spilled over the years for the liberty we now enjoy. If living in a free society means we have to watch dudes kissing on TV, I'd say that's a bargain price for a lot of protected liberty.

Mazel Tov.

When I was little, we used to have Smog Alerts in Los Angeles fairly regularly, sometimes for a few consecutive days. My elementary school used to keep us inside on those days, and I used to stand on the second floor balcony that overlooked the foothills, staring at the crap in the air. Around noontime, it looked like an overcast sky, but without the ceiling effect. It diffused all the way to the ground. Then, in the afternoon, the sky would explode in a malignant display of colors. The horizon was capped by a black line hovering above the ground with a mantle of crimson and orange, like the lips of a steamed muscle. The sun would squat over the ocean in a rust-colored splotch smeared across a quarter of the sky. Shadows turned the color of tea, and the air turned pinkish and cloudy like you were peering through gasoline. It looked genuinely dangerous.

Astonishingly, those days were a measured improvement over what my parents experienced. The smog used to be thick enough to obscure the sun completely, turning the daylight into a diffuse glow. Sometimes, it blocked enough of the daylight to create a sort of murky twilight. Here is the first known photo of LA's smog, from 1943 :

Beijing is like that, except the mantle of smog is much, much wider than the one that covered Los Angeles in its worst years. For the Olympics, China has been working to improve the situation, but the progress so far is not very impressive. Days with good air quality, called "Blue Sky" days, would be emergency smog alerts in Los Angeles. The Beijing Air Blog has some interesting data on China's ongoing battle with air pollution, though there haven't been many posts in a while. Here is Tienanmen Square on April 27, 2008, which was officially a Blue Sky Day :

The smog extends pretty far from the city. This is the shot from a train window about a hundred miles north of Beijing. The factory (refinery? LNG plan? cement factory?) is only about a mile or two away, and it's almost completely invisible.

I'm not going to delve into why this is a bad thing. Global warming, cardiopulmonary disease, lead, mercury, yadda yadda. You already know the arguments, or you can make your own. Here's a reason that doesn't require any sort of scientific background to understand. The day after I took the photographs above, a heavy thunderstorm scrubbed the smog out of the sky. This is what China is supposed to look like :

China is a damn beautiful country, when you can see it.

I keep meaning to sit down and write a blog entry about what it's been like so far, but things keep happening at a break-neck pace, and I just haven't had time. I only have a few minutes to write something, so I'll write about one of the small annoyances of this crazy place: Plumbing.

As everyone knows, China is making a huge effort to modernize. For the most part, it has been quite successful. In America, we mostly experience China's modernization in the form of the ever-escalating technical complexity of Chinese imports. Not so long ago, only crappy plastic toys and knock-offs had Made In China stickers. Today, you are probably reading this post on a computer made mostly out of parts bearing the same imprint. However, the overwhelming majority of China's modernization is for domestic consumption only. The streets are jammed with cool Made In China products that you will never see in America. The electric scooters, for example. The cell phone service is better in your average one-horse Chinese village than it is in Los Angeles.

Americans tend to assume that most of China's economy is geared toward exports; it isn't. The flood of Chinese goods we see coming into the Port of Long Beach is just the oversplash of China's industrial berserker rage. Most of it stays right here.

On the other hand, they don't seem to have quite figured out plumbing. I was trying to figure out why my 17th floor hotel room always smells like a sewer. It occurred to me that maybe there was something wrong with the drain. Notice anything missing?

That's right. No trap. From the booming roar that issues from the drain every time I use it, it sounds like it's a pretty straight shot from the sink to the sewer main in the basement, seventeen floors down.

Whoever designed this fixture was clearly aware of this problem; the drain has a built-in airtight, noise insulated drain cover. They opted for a heavy rotating high pressure plug instead of a little bendy bit in the pipe.

As Mimi would say, "That's China."

From somewhere above the Mongolia/Siberia frontier.

I suppose it is somewhat fitting that, on my way to visit the planet's newly crowned Number One Emitter of carbon dioxide, I should get a fantastic view of the patch of the planet that all this carbon dioxide is having the most dangerous effect. I visited Greenland in 1993, so it's interesting to see what it looks like 15 years later. Normally I think out-the-window shots are pretty crummy, but I think these make up for their poor image quality and composition by being pretty damn interesting.

This is the ice pack on the Davis Straight, between the west coast of Greenland and Canada. As you can see, there really isn't any pack ice. In August of 1993, we had planned to sail across the straight to visit the Baffin Island. We had abandon those plans because the pack ice was too heavy to navigate, even for our specially equipped vessel. We had to hug the coast of Greenland, following shipping lanes kept clear with ice breakers.

This is the west coastline of Disco Island. In 1993, it was kind of impossible to tell where the pack ice ended and the island started. Now, it's pretty obvious. After we visited Disco Island, we spent a few rough days hammering our into Baffin Bay. The noise of the ice crashing against the hull was awful. Imagine being trapped in a garbage can while someone beats it with a chandelier. We gave up and turned around after a few days of it.

This is Disco Bay. In 1993, I remember standing on the Greenland side. The pack ice on the bay had ruptured, but it was very thick and clogged with icebergs. The noise of the ice grinding and grumbling on the chop was so loud that it was impossible to have a conversation without shouting. Now, it looks like the Charles River in Boston around springtime.

Here is a glacier on Disco Island, just 'cause it's awesome.

I have a bad habit. I often open my IMAP mailbox directly on the mail host with mutt. This inevitably causes occasional complicated messes when I butterfinger something. For example, a few days ago I accidentally moved all of the read messages to a separate mailbox. I merged the message back in, but not before my desktop, which was patiently monitoring my IMAP mailbox on the other side of town, decided to synchronize a few thousand messages with the IMAP server. This resulted in lots and lots of duplicate messages.

The trouble was, the duplicate messages had different X-IDs so, their MD5 hashes would be different. After fiddling around with formail for a few minutes, I got impatient and banged out this fun little Python hack :

import email, imaplib, getpass

M = imaplib.IMAP4_SSL( '**********' )

typ, data = M.login( getpass.getuser(), getpass.getpass() )
if typ != 'OK' :
    raise Exception, 'Login failed.'

typ, data = M.select()
if typ != 'OK' :
    raise Exception, 'Selection failed.'

typ, data = M.search( None, 'ALL' )
if typ != 'OK' :
    raise Exception, 'Could not get message IDs.'

id_list = data[0].split()
mids = []
for id in id_list :
    typ, data = M.fetch( id, '(RFC822)' )
    if typ != 'OK' :
        raise Exception, 'Could not fetch message ' + id
    mail = email.message_from_string( data[0][1] )
    mID = mail.get( 'message-id' )
    print mID
    mids.append( (mID, id) )

mids.sort()

dupes = []
for i in range(len(mids)) :
    if m[i] == m[i+1] :
        dupes.append( m[i+1] )

print 'Found ' + len(dupes) + ' duplicate messages.'

for m in dupes :
    typ, data = M.store( m[1], "+FLAGS", '(\\Deleted)')

print 'Marked ' + len(dupes) + ' for deletion.'

typ, data = M.expunge()

print 'Expunged ' + len(data.split()) + ' messages.'

Duplicates begone!

It's a little annoying that imaplib doesn't have a friendly wrapper function for marking messages for deletion, but M.store( m[1], "+FLAGS", '(\\Deleted)') does the job just fine.

I'm going to China in about a week to visit Mimi. I'll be in Beijing for about twelve days, and I'll have about $500 to spend. What should I do?

For the last couple of years, I've been running Typo, a Ruby on Rails blogging tool. It was nice, but there were a few persistent problems I encountered :

• It was sloooooow. Nothing I did seemed to get it to run faster, even with carefully tuned caching.
• It was unstable. Typo would run happily for months, and then mysteriously explode. This usually happened while I was traveling, or busy with something more important.
• It was difficult to fix. Usually, when Typo would come down, it took a few days of research and pestering people to figure out why.
• The database migrations between versions were awful. You'll notice that the first year of posts don't have any tags. They were deleted by a bad migration. I have backups, but merging them back in is nightmarish.

A lot of the problems I experienced are with older versions of Typo. They've definitely gotten better over the years. But there is one big reason I'm abandoning Typo; I don't want to code in Ruby. I do most of my coding in python. I like python. I seems silly not to use the knowledge I have from doing computational physics in python.

I have used Blogmaker for most of the main elements on my site, but with a fair bit of hacking to make it do more of what I want. I also wrote a Typo-to-Django import utility, if anyone is interested. The URLs are slightly different, so I'm going to watch the 404s for a few days.

The Hitachi 1.8" hard drive in the IBM X40 is probably the worst data storage product I've ever used. It is expensive, excruciatingly slow, irritatingly loud, and non-standard. There are basically no options for replacement except to just buy another one. And, as I discovered to my sorrow, it is also fragile and unreliable. So, I decided to replace it with a Compact Flash card.

You may have heard something about Solid State Drives (SSDs), such as the one available as an option for Apple's MacBook Air. You can think of this project as sort of a poor-man's version of these products.

While most CF drives are relatively small and expensive, there are a few products that seem to sacrifice speed for capacity. This may seem sub-optimal, but the drive it will be replacing is astonishingly slow to begin with. According to hdparm, it can do buffered reads at 18 MB/sec, but in practice that seems pretty optimistic.

If I understand correctly, the Compact Flash interconnect standard is basically a subset of IDE. So, you just need a little passive adapter board, and you can plug a CF card directly into an IDE port. I used a D44MIDECF adapter card from Addonics. At $20, it's a little overpriced. There are no active components, and the board contains only the CF plug, the 44 pin IDE pinout, a jumper, a surface mount resistor, a surface mount capacitor, and a surface mount LED. On the other hand, it is something of a specialty part, so I suppose I should be happy that they bothered to sell it to me at all. For the CF card, I found this monster on NewEgg.

The X40 doesn't have removable media (other than the SD/MMC reader). I've always hated fiddling around with boot floppies and installers anyway. Supposedly, Debian has gotten their installer in better shape since I last played with it. That was more than five years ago. I just skipped that whole process, and built out a minimal Debian install by hand. I popped the CF disk into my SanDisk USB Flash reader, and did the following :

sudo fdisk /dev/sdc 
   # created a 31 GB primary partition tagged as Linux [id 83]
   # and a 1 GB primary partition tagged as Linux Swap [id 82]
sudo mkfs.ext3 /dev/sdc1
sudo mkswap /dev/sdc2
sudo mount /dev/sdc1 /mnt/flash
sudo debootstrap sid /mnt/flash/ http://linux.csua.berkeley.edu/debian
sudo chroot /mnt/flash
vi /etc/apt/sources.list
apt-get update
apt-get dist-upgrade
apt-get install linux-image-2.6.24-1-686 grub sudo 
mkdir /boot/grub
update-grub
vim /boot/grub/menu.lst
exit
sudo grub-install --root-directory=/mnt/flash --recheck /dev/sdc

Then, pop the CF card in its little adapter board into the drive bay, and boot. Hooray! Here is how hdparm identifies the CF disk :

/dev/hda:

 Model=, FwRev=20070912, SerialNo=CF CARD 000040D9
 Config={ HardSect NotMFM Fixed DTR>10Mbs }
 RawCHS=16383/15/63, TrkSize=0, SectSize=576, ECCbytes=4
 BuffType=DualPort, BuffSize=1kB, MaxMultSect=1, MultSect=off
 CurCHS=16383/15/63, CurSects=15481935, LBA=yes, LBAsects=63438848
 IORDY=no, tPIO={min:120,w/IORDY:120}, tDMA={min:120,rec:120}
 PIO modes:  pio0 pio1 pio2 pio3 pio4 
 DMA modes:  mdma0 mdma1 *mdma2 
 AdvancedPM=no

 * signifies the current active mode

The default IDE settings for the CF drive result in very slow performance, so some tuning is in order. I edited /etc/hdparm.conf accordingly :

/dev/hda {
        write_cache = on
        io32_support = 3
        dma = on
        lookahead = on
        interrupt_unmask = on
}

Here is the output of the script :

Setting parameters of disc:
/dev/hda:
 setting 32-bit IO_support flag to 3
 setting unmaskirq to 1 (on)
 setting using_dma to 1 (on)
 setting drive read-lookahead to 1 (on)
 setting drive write-caching to 1 (on)
 IO_support    =  3 (32-bit w/sync)
 unmaskirq     =  1 (on)
 using_dma     =  1 (on)
 look-ahead    = not supported
 write-caching = not supported
  /dev/hda.

The result is actually a little faster than the Hitachi hard drive :

sudo hdparm -Tt /dev/hda

/dev/hda:
 Timing cached reads:   1474 MB in  2.00 seconds = 737.30 MB/sec
 Timing buffered disk reads:   44 MB in  3.13 seconds =  14.06 MB/sec

So far, I'm pretty happy.

Now that it looks like the Pentagon is finally ready to use the Military Comissions Act, I think it's important that we all get something straight. Waterboarding is not "simulated drowning." It does not "mimic the sensation of drowning." It is actual drowning. Just as you can choke on a under-chewed wad of burger meat without actually choking death, you can drown for a couple of minutes without expiring. It is absolutely possible to kill someone in the process of waterboarding them.

So yeah. It's torture. And we did that to some guy as part of an investigation by the duely constituted authorities. America is in the torture business, and it's official. The only question now is what sort of paperwork has to be filed for torture-induced confessions to be admissible in the tribunals, which by the way, are entirely under the direction of the executive branch.

The only question is this: Can we be as good at show trials as the Soviet Union? It's a challange, but I have great faith that us dilligent, hardworking can-do Americans can put together the most justice-y show trial yet.

Here's my ballot for the 2008 California Democratic primary. As you can see, I voted for Obama. I hope you will vote for whoever you feel would be the best nominee, but some people may be intersted to hear my reasons for voting as I have.

Why I Won't Vote for Hillary

Hillary's campaign has focused relentlessly on one theme: Experience. She's been fighting for middle-class Americans for a long time, particularly on the subject of health care. People who don't like her have tried to minimize Hillary's role in the Clinton White House; they evidently don't remember the 1990s. The trouble is not that I don't think she has the experience, it's that I'm not particularly impressed by her accomplishments.

That's a pretty sweeping assertion, so let me offer the most important example of what I am talking about. The touchstone moment of Hillary Clinton's tenure in the White House was the introduction of the health care package. At the time, it was clear that health care was in crisis, and the plan assembled by the Clinton White House under Hillary's supervision probably would have more-or-less ended the crisis. I'm not going to claim that it would have been a great system, or that it was a wonderful piece of legislation, but it was clearly a bold step in the right direction. Unfortunately, the bill failed, and it failed so spectacularly that it hobbled Bill Clinton's domestic agenda even after his successful reelection.

Why did it fail? It failed for a lot of reasons, but here are the ones that stick in my mind :

• It was a gigantic piece of legislation, more than a thousand pages of dense legal jargon. I still remember the news clips of Congressional aides setting out copies of the bill on overloaded, buckling folding tables. There was no hope whatsoever that an ordinary person, even a very motivated one, could have learned enough about the bill to understand it on its merits.
• The bill was produced in secret. The Association of American Physicians and Surgeons even went as far as to sue the Health Care Task Force to find out what was happening in the closed meetings. They were drafting legislation that would change the whole health care system, and they shut out the doctors. Dumb, dumb, dumb.
• The plan itself was a hideous chimera; the idea was to take the scenario under which most Americans obtain health care coverage (i.e., from their employer), make it mandatory. Then, there was a system of price controls, and various other administrative thingamajigs... In short, it lacked any kind of unity of vision that would have allowed the Clintons to articulate how it was supposed to work.
• The Task Force deliberated for a very long time to excrete this gorgon of a proposal, and by the time it was out in the open, the initial enthusiasm and excitement had evaporated. The bill's opponents had a nice, long time to organize their attack. The attack went off like clockwork, and Newt and his cronies rode the momentum of this attack into the 1994 elections and seized control of Congress. The Clinton's didn't just loose the health care bill, they lost every bill that could have been promulgated to a Democratic Congress.

Universal health care is a pretty grand endeavor. You'd have to look at the Social Security Act to find a piece of legislation with a similar breadth and scope, so let's take a peek at the Social Security Act of 1935. It represented a historic change in the relationship between citizens and government, but the legislation is only a few dozen pages long. It doesn't take long to read, and an ordinary person can pretty much follow what most of the bill does.

The original act has been updated several times since the program was created, but the original legislation completely captured the theory, practice and most of the essential features of the program. It was fairly simple, it was astonishingly efficient (even before computers), and it works.

Hillary's health care bill didn't fail because the nasty Republicans killed it. It failed because it was a murky tangle of legal spaghetti-code constructed in secret under dubious circumstances and championed by a callous, tardy and tone-deaf technocrat.

Hillary claims that she's learned from her mistakes. On a personal level, I'm more than happy to forgive her. I think she made an earnest effort to do something good for a lot of people. However, the fact remains that we've seen Hillary spearhead a major legislative effort, and she did just about the worst job you could possibly imagine.

There are a lot of people who are very excited about the prospect of a female president. I think it would be pretty great, actually. On the other hand, she is running for president. You don't put someone in that office because you like them and think they deserve your loyalty. You put them in that office because you want them to do a good job, period. The presidency is not a reward; it is a duty. It should be given to person best able to peform that duty, and Hillary has an established record of arrogance and poor decisions.

Women have fought for a long time to be taken seriously in the workplace, in academia, and in politics. I take Hillary seriously, and I seriously don't want her to be president. She clearly has the brains and the grit to be president, but then again, I don't think she's particularly unique among women in that regard. There are millions of women who could competently serve in the capacity of President of the United States. There are women out there doing much harder jobs.

The Clinton campaign mantra is that Hillary is experienced. Yep, she certainly has lots of experience fighting for good, worthy things. On the other hand, she also has a conspicuously inauspicious track record when it comes to accomplishing these good, worthy things. She and her husband presided over the Democratic Party's most devastating legislative failure of the 20th century. I don't see why we, as voters, should reward failure.

Since then, Hillary has managed to help precipitate a number of other spectacular legislative failures :

• Voted to authorize the Iraq war
• Voted for the PATRIOT act (twice)
• Voted to confirm John Roberts

On the Other hand, we've got Barack Obama. Mr. Obama might not have quite as impressive a resume as Mrs. Clinton, but

1. he is nevertheless an astonishingly accomplished individual and
2. he has never done anything to wreck the Democratic Party.

Both Obama and Clinton are clearly competent to hold the office -- especially in contrast with its current occupant. Mr. Obama is more charismatic, though I thik more has been made of this point than it deserves. The reason I am voting for him is that of the candidates on the ballot, he is the one with the best record of good decision making. I don't agree with everything Mr. Obama says -- I emphatically agree with Paul Krugman on the topic of mandates -- but I think Mr. Obama is the most likely candidate to actually deliver a health care package. Mr. and Mrs. Clinton had their chance, and they blew it.

Random discovery of the day : If you should happen to find yourself at the grocery store without a membership fob, or if you don't want to sign up for a membership, you can always use the phone number from the Tommy Tutone song 867-5309 (Jenny). Pretty much any area code will work.

A friend of mine has asked if I can explain why Bill Clinton enjoyed, and continues to enjoy, relatively high popularity despite the troubles he faced in office. Obviously, one can only speculate about workings of another's mind, but in this case I think it may be possible to speculate with some measure of confidence.

The first possible explanation is that there are simply more Democrats than Republicans.

However, this doesn't really explain very much by itself. The glib talk-show explanation of Bill Clinton's popularity is that the economy was good during the Clinton years, ergo Clinton was popular. End of story.

Of course, the president does not have much direct influence on the health of the broader economy, and it is not unreasonable to suppose that most Americans who fondly remember Mr. Clinton's tenure are aware of this. A more nuanced explanation is required.

It will probably come as no surprise that I have my own theory. We are, after all, speculating on the thoughts and feelings of millions of total strangers, so my theory is probably as good as any, or perhaps at best slightly more plausible. At least it does not suffer from the obvious bogosity of the it-was-a-good-economy theory. Since theories are supposed to have names, I will name my theory Popularity Due to Reduced Rate of Disaster.

The theory goes like this. While the president does not have very much influence over the immediate overall health of the economy, they can exercise a large amount of influence over specific aspects of it. Particularly, the White House can be enormously effective at wrecking things. You don't need thermodynamics to tell you that it is easier to make a mess than to clean one up.

So, why is Bill Clinton relatively popular, and George W. Bush so unpopular? If you look for explanations in ideas and politics, you might be able to formulate some sort of explanation based on how much Americans tend to agree with the thinking of the current and former occupant of the White House. This sort of analysis is the bread and butter of TV pundits. Happily, most Americans don't think like the gasbags on TV, and so the ideological analysis offered there is very likely wrong.

I think it is more reasonable to suppose that Americans draw conclusions from the evidence that they encounter in their own lives, and have a mostly casual or academic interest in aggregate effects like GNP growth or the nominal inflation rate. This is probably why so many Americans think we are in a recession even though the GNP is growing: If you're working hard but struggling financially, then the economy sucks, and you're not likely to feel otherwise upon hearing that GNP is growing and the nominal rate of inflation is low.

So, when a president wrecks part of the economy, it may not register significantly in macroeconomic diagnostics, but it may have a big impact on how large numbers of individual people feel. I think that this is probably the most plausible model for popular opinion, at least as a first-order-approximation. A person may be ideologically inclined to agree with a president, but if that president does something that directly harms that person, I don't think the ideological agreement matters very much.

Looking back on the Clinton presidency, it is difficult to point to anything remarkably wonderful that he did, especially when set alongside other multi-term 20th century Democratic presidents (e.g., FDR). But perhaps more importantly, it is also difficult to point to anything remarkably bad, either. The worst thing Mr. Clinton did, most people agree, was have "sexual relations" with a consenting adult, and then lied about it. Sure, it was sort of embarrassing, but it had no impact whatsoever on any American, save for the dozen or so people with a personal stake in the matter. Americans came to the sensible conclusion that it wasn't really any of their business and wasn't really very important, and so the dual impeachment efforts in Congress and in the media were spectacularly unpopular.

When Mr. Clinton was still in office, the friend who posed this question remarked that the aspect of the Lewinsky incident that bothered him most was that Mr. Clinton's brief affair happened "on the public dime" and on public property. These are legitimate points, but one should keep in mind that the man was working sixty to eighty hours a week. Even if we deduct the time wasted on the affair, the public still got a fantastic bargain in terms of dollars paid per hour of presidential work, especially when contrasted with Mr. Bush's short work week and frequent, lengthy vacations. Of course the celebrated liaison happened in the Oval Office; Bill Clinton worked longer hours than a galley slave.

As far as practical impacts on individual lives, Mr. Clinton was clearly not a very bad president. In some moderately important ways, he managed to do some real good, but that probably isn't why he's popular. The real reason, I think, is the sharp contrast with the presidents before and after. George W. Bush has managed to wreck an extraordinary number of things. For example cities New Orleans and Biloxi, habeas corpus, the first, second, fourth, firth, sixth, seventh, eighth, ninth and tenth amendments to the Constitution, America's international reputation, the nation of Iraq, the World Bank, the Department of Justice, an so on. While Mr. Bush has not actually destroyed any of these things, and I think they each will eventually be rebuilt, the damage done nevertheless is real. It has had real, widespread impacts on the lives of ordinary Americans.

Rather than speaking generally about these things, I think it would be more illustrative to delve into three anecdotes that I think are representative of the sort of damage that happened before and after Mr. Clinton's presidency. Each of these events has caused substantial material harm to individual Americans.

Skid Row

Since I live in Los Angeles, I am practically compelled to mention the death-blow Ronald Reagan dealt to America's the mental health care system. As governor of California, he called for the firing of 3700 mental health employees from the Department of Mental Hygiene in 1969. The California legislature reduced the layoffs to 2600 employees and began construction of new treatment centers to replace the old-fashioned residential hospitals that were to be closed. In the resulting departmental turmoil, tens of thousands of very sick people were literally dumped onto the streets of California's cities. Most of them stayed on the streets. As the Vietnam War chewed through the draft-eligible population in the following years, a disproportionate number of these new mentally ill homeless were veterans suffering from what we would now call PTSD.

To give you an idea of why this screw-up has had such permanent consequences, you have to remember the time period in which all of this was happening. This was the early 1970s, a period of weak economic growth extremely high inflation. It was very hard on middle class families. If you were a discharged mental patient or a veteran with brain trauma, it was simply impossible to get by. The network of treatment centers has turned out to be almost completely impotent.

When Reagan became president, he duplicated these policies on a national scale. Mentally ill people flooded into city centers across the country. Many of these cities are lethally cold in the winter months, so many mental hospitals and cities evidently used the last dribbles of federal money to buy one-way train tickets for their patients. They sent them to the one city that everyone knew was nice and warm in the wintertime, and already had a big enough homeless population that no one would notice a few more: Los Angeles. If you look at the distribution of LA's homeless population, it is still clustered near the rail terminus.

Before Reagan, Los Angeles didn't have a very significant homeless population. Today, it has a permanently homeless population of 82,000 people, and at some point during the year, and additional 254,000 Los Angeles residents are homeless for some period of time.

The evence is even more offensive upon revisiting the reason it was carried out. The mental hospitals were shut down because Reagan believed that they were inefficient, and that it would be simpler to scrap the system and build a new one than to attempt reforms. All of this human misery was for the sake of speeding up the realization of a relatively insignificant cost savings.

Stranded at the Airport

My second example, again from Reagan, is the Air Traffic Control system. The Professional Air Traffic Controllers Organization went on strike to protest long hours, low pay and unsafe working conditions. Let me repeat that last one. The air traffic controllers went on strike to protest unsafe working conditions. Not unsafe for themselves, but unsafe for the traveling public. It is the only example that I know of where a trade union has gone on strike for the sake of public safety. Reagan ordered them back to work, and when they refused, he fired them en mass, and banned them from government service forever.

The fallout of Reagan's decision has left an indelible mark on America's transportation system. The positions left open by the fired air traffic controllers were filled by managers, non-union controllers, and temps. To decrease the likelihood of accidents, the FAA was forced to enlarge the minimum safety envelopes around aircraft. With low wages, long hours, ancient equipment (which hasn't been upgraded since the 1960s), poor benefits and terrible morale, it's been virtually impossible to hire new air traffic controllers. So, the conditions that triggered the strike in the first place have actually gotten worse. Reagan's purge of air traffic controllers drastically reduced the safety and the throughput capacity of the entire civil aviation system.

In some very busy airports, this throughput capacity reduction is substantial. Nearly all airport delays can be ultimately attributed to congestion at a handful of very busy airports. This congestion is a consequence of the larger safety envelopes required by the FAA to allow them to do without the 11,000 highly-trained professionals that it can neither replace nor re-hire. So, next time you're stuck sitting on the tarmac or at the gate, you can thank Ronald Reagan for putting union-busting ahead of public safety and the operational effectiveness of the FAA.

It's worth noting that both the Teamsters and PATCO endorsed Reagan in 1980.

Backdating

The last example I will give is somewhat personal and esoteric, but it is perhaps the most important. Over the last three years, many companies have been caught doing something called option backdating. The scheme works like this. An option is an agreement with the issuer of a security -- in this case, stock certificates issued by the board of directors of a company -- to either buy or sell the security at a particular price. Executive compensation packages often contain a basket of options at various prices. Usually, these options are held in escrow until a specified date, at which point they are released from escrow. The recipient may the "exercise" the option, which in this case means either buying or selling the security at the agreed upon price.

In the case of stock options, boards usually issue options based not on a price, but rather the at a price on a particular date. The scandal that has been swirling around a number of companies, including high-fliers like Apple, is that they issued stock options to their executives that had price-point dates before their issue dates. An option is supposed to be a security whose value is based on the price difference between now some point in the future. This is why options are sometimes called "futures." However, if you issue an option whose value is based on the difference in price between the price now and some point in the past, then you you know exactly how much the option is worth. In other words, it's not an option at all; it's cash.

What Apple did, and what hundreds of other companies did between 2002 and 2006, was issue these "backdated" options to their executives. Each instance of options backdating constitutes three separate acts of fraud :

1. It allows the company to directly pay their executives billions of dollars in cash, but expense the associated costs as operating overhead instead of payroll, thus hiding the actual impact of executive compensation from investors.
2. It allows the companies to avoid paying payroll taxes on this money, depriving Social Security and Medicare/Medicaid of billions of dollars.
3. It allows the executives themselves to declare the money thus received as capital gains instead of income, on which they pay 22% instead of 46%.

The companies who were caught doing this were finally asked to stop sometime last year. Insofar as I can tell, there has been no substantial punishment for options backdating yet.

I did not really appreciate the magnitude of this scandal until I talked about it with my father, who has extensive experience as an entrepreneur and has served on the boards of several companies. My father started a company called Teradata (NYSE: TDC). Teradata makes database computers.

My father once explained to me that there were only two entities that posed a serious threat to his company: IBM, and the Securities and Exchange Commission. Teradata went after IBM's main business, courting some of IBM's most lucrative customers. When the company was still operating out of a grubby little building near the LA airport, they went toe-to-toe with IBM in the marketplace, and they prospered. My father was very worried that IBM would do something illegal to destroy his company, but fortunately, IBM played fair.

As scary as it was duking it out with the largest technology company on Earth, what really scared my father was the Securities and Exchange Commission. He was absolutely terrified that a there would be some sort of mistake in their accounting, or in their public filings, or in their communications with investors, that would bring down the wrath of the SEC. As soon as Teradata was incorporated, he made sure that he had the best accountants and the best lawyers he could possibly find, and he demanded absolute perfection from them. My father loathes accounting, but he spent more time checking the ledgers than on the engineering of the computer that he himself had invented. That is how scared he was of the SEC.

That is how scared everyone was of the SEC in those days. It was assumed that even a small error in the corporate accounting would lead immediately to the destruction of the company and the end of the careers of everyone involved.

When I was much younger, I once complained that it was unfair for the SEC to impose such stiff penalties. My father responded angrily, "No, it's not unfair. Teradata is made out of other people's money." Even while the ax was hanging over his own neck, my father strongly supported this strict regulation.

When Teradata was founded, no one would have dared something as shady as options backdating. They would have been ripped to shreds. So, why did it happen? Simple. George W. Bush nerfed the SEC. Companies know that America's financial cops don't have any bullets.

When you look at the credit crunch, the looming subprime disaster, and the wave of mortgage foreclosures crashing down on America's middle class, it shouldn't be any surprise how it happened.

Gamesmanship or statecraft?

Returning to the question at hand, why is it that people like Bill Clinton? That's easy. He didn't wreck anything. He appointed mostly competent bureaucrats to lead federal agencies. The ones that weren't competent got fired. He understood that the president's job is to make the government work, and he logged eight years of eighty hour weeks to make sure that it did.

His ideology was not neither inspired nor inspiring, but people like him anyway. This was the great puzzle that the conservatives who opposed him have never figured out. Newt Gingrich and Tom DeLay believed that politics is all about ideas, and as far as campaigns are concerned, they were right. However, good government is not about ideas. It is about duty, service and implementation. Government doesn't run on ideas, it runs on deeds. In that respect, government and politics are very different activities.

Bill Clinton is popular because he was pretty good at government. Newt Gingrich, Tom DeLay, George Bush and now the whole Republican Party are deeply unpopular because, while they are exceptionally good at politics, they are miserable failures in government. As long as Republicans continue to confuse politics and government, they will remain puzzled by Bill Clinton's enduring popularity.