Russell's Blog

New. Improved. Stays crunchy in milk.

LA Natural History Museum doesn't grok citations

Posted by Russell on March 18, 2013 at 8:25 a.m.

Earlier today, I received a request to use one of the photographs I've posted on Flickr. I get a lot of these requests, and I always find them a bit annoying; I release all of my photographs (and writing, including this blog) under a Creative Commons Attribution license.

I would be delighted if people emailed to say, "Hey, thanks for letting me use your photo! Here's a link to what the thing I'm using it for." Even that isn't strictly necessary, since I always notice the inbound referrals from the attribution links. The whole point is that you don't need to ask permission because you already have it, provided you give proper attribution. So, as usual, I tried to explain this concept, and got an interesting answer.

Hi Russell,

Thanks for your email. That's neat to hear that you have a connection to the Museum.

Yes, I did notice that your photo was offered under a Creative Commons license. In the case of this particular video, however, we are crediting contributors by name only (ie "Credit: Russell Neches". That is one of the reasons why I contacted you directly, to see if you would be willing to waive the standard CC attribution requirements.

If it is ok to only credit using your name, please let me know. Your credit will appear on the image itself. We are also looking to label each photo with the location where the image was taken. Based on the tag, I assume the Opossum image is from Pasadena. Please correct me if I am wrong.

Look forward to hearing from you.

Thanks again,

Sam Easterson

Sam Easterson
Senior Media Producer, Nature Lab
Natural History Museum of Los Angeles
900 Exposition Blvd.
Los Angeles, CA 90007

Wait, he wants me to waive the CC-BY license just so they can avoid actually linking to the original photo in the credit? That doesn't make a bit of sense. Yes, I want credit for my work, but that's not why I licence under CC-BY. Even if something is in the public domain, nobody has the right to plagiarize from it, and an author can and should expect their public domain works to be properly credited. You can copy it, and you can cut it into bits, rearrange the bits, paint the whole mess orange and trade for a silly hat. However, you cannot claim you created the original, because, well, you didn't. That would be fraud.

The reason I use CC-BY instead of Public Domain is because it requires anyone using my work to provide useful attribution information. This is basically the same standard of attribution used in science. Scientists have to cite the work of others in such a way that the reader can actually identify and obtain the cited material for themselves. It's about access, not just credit.

So, I try to explain...

Ah, I see. Well, I suppose I should explain myself then.

The reason I release my photos under CC-BY rather than Public Domain is because I believe it is important that the practice of traceable attribution be extended to new circumstances. It is important because it is often very important that people be able to ascertain where a particular piece of media came from. For example, they may wish to find related materials, or they may wish to independently verify its authenticity. This is why standard citation formats in research papers are so important. Giving credit is necessary, but not sufficient. The reader must able to actually access the source material, or they aren't really in a position to exercise judgment.

Now, I understand that this can be awkward when you're outside the traditional media formats where there is an acknowledged code of conduct for citations. There isn't yet a "standard" way to include citations in a slideshow, or in a dance performance, or in an opera, or in a sculpture. It's easy to imagine how doing it badly could mar the work.

Nevertheless, I think it needs to be attempted. The Natural History Museum is the sort of institution that is most likely to actually get it right and to set trends that others will follow. Everything in the museum has to meet pedagogical, scientific and aesthetic goals. It's one of the things that makes science museums so awesome.

I think developing some best practices for incorporating traceable citations into a mixed media installation is perfectly in keeping with that. After all, you're not using these images to sell toothpaste. You're using them to teach the public about science and nature. One of the most important practices in science is making sure the audience has direct access to the sources. Science regards the audience as peers, not as consumers.

Now, I'm not designing the exhibit, so I'm not going to insist on any particular design solution for providing links. I'm sure you can think of something that will work wonderfully, and won't be much trouble.

I can also imagine how an exuberant use of citations could make the exhibit like what you're describing extremely awesome. For example, a smartly-designed footer on each image with a scientific name, common name, time, location and a QR code link. Patrons could say, "Ooo! What's that?" and snap a photo with their phones, and be taken to a page with lots and lots of details about the organism and the source image. That's not necessarily what you should do, but perhaps you see what I mean about why citations are important? They make media more awesome!

As for the furry fellow in the picture, I found these guys in Eaton Canyon after their mother had been killed by a coyote. The ranger gave the babies to me, I suppose, because she didn't want them to be eaten by hawks in front of a school group on the hiking trail. They stayed at my mom's house in Pasadena for a few weeks until they were big enough to eat and do opossum-y things, and then I released them back into Eaton Canyon. The photo was taken in her backyard.

Russell

I was hopeful that this would click. There tons of easy things they could do to house the links. They could make a page on their website somewhere that said "attributions page for exhibit X" with a list of photos and attribution links. It would just take a few minutes, and it would be useful.

But alas, no.

Thanks for your email Russell. I very much appreciate your thoughts.

Unfortunately, in this case, I'm not going to be able to accommodate your request.

I'm sorry that I won't be able to include your image in the slideshow after all. My apologies for taking up your time.

Sincerely,

Sam

Think about this here. He says, "I'm not going to be able to accommodate your request." Remember who's requesting what here. He really means, "I'm not going to be able to comply with the terms of your license."

So, I'm pretty disappointed. I don't care if they use my photo or not. I get thousands of views already. My photos get used for lots of things, including a couple of elementary school science textbooks in developing countries. The publishers didn't have any problem putting a link next to my name.

No, I'm disappointed that the Los Angeles Natural History Museum doesn't seem to understand why citations are important.

My papers, for Aaron Swartz

Posted by Russell on January 14, 2013 at 7:49 a.m.
This past Friday, I was enjoying a dinner party with some friends in Brooklyn. Elsewhere in Brooklyn, Aaron Swartz, a fellow I have long admired, hanged himself after two years of being stalked, bullied and harassed by those we employ to Serve and Protect. He was being prosecuted for downloading a bunch of academic papers. Papers to which he had legal access, and whose content was overwhelmingly funded by taxpayers. His "crime" was that he downloaded a lot of them, although the publisher imposed no particular limit on how many he could download, and that he downloaded them from a network he perhaps didn't have permission to use. The "victims," JSTOR, the publisher, and MIT, the owner of the network, were not the least interested in pursuing either a civil or criminal case against Aaron.

Perversely, the Department of Justice and the Secret Service thought otherwise. The US Attorney's Office was about to go to trial with charges that would have resulted in thirty years of imprisonment were Aaron convicted, but I can't imagine that Aaron hanged himself because he was afraid.

Aaron was a patriot and a humanitarian. He was dedicated to the work of delivering a dose of integrity to the institutions of democracy, even as those very institutions crushed him for... for what, exactly? Sport and amusement, it seems. The People's case against Aaron Swartz, as represented by US attorney Carmen Ortiz, only makes sense if the People are sadistic bullies. It's hard not to wonder if Carmen Ortiz was planning to run for elected office, and if so, it's impossible to see Ortiz' case against Aaron as anything other than a cold-blooded gambit for future campaign donations from the media and publishing industries. Aaron's destruction was to be a signal that Carmen Ortiz is tough on piracy. Grist for the mill of our perfectly-legal political corruption.

That's not paranoia. That's politics in America. Aaron was deeply committed to healing the necrotic tissues of America's democracy. Over the last two years, reading about the case against him absolutely boiled my blood, but it must have broken Aaron's heart. Perhaps he despaired that America can be saved from the rot, or could no longer withstand the pain and humiliation of being so ill-treated by the republic he cared so much about.

As my tribute to Aaron, I've downloaded all of my own papers and posted them here. Since joining Jonathan Eisen's lab, I've been publishing in Open Access journals, and so the two most recent papers are perfectly legal for me to post here. The first three were written before I worked for an advisor who understood what is really at stake in scientific publishing, and so they are not open access. Here they are anyway. For Aaron.

  1. Functional biogeography of ocean microbes revealed through Non-Negative matrix factorization.
    Xingpeng Jiang, Morgan G. I. Langille, Russell Y. Neches, Marie Elliot, Simon A. Levin, Jonathan A. Eisen, Joshua S. Weitz, and Jonathan Dushoff. PLoS ONE, 7(9):e43866+, September 2012.
    doi:10.1371/journal.pone.0043866
  2. A workflow for genome-wide mapping of archaeal transcription factors with ChIP-seq.
    Elizabeth G. Wilbanks, David J. Larsen, Russell Y. Neches, Andrew I. Yao, Chia-Ying Wu, Rachel A. S. Kjolby, and Marc T. Facciotti. Nucleic Acids Research, February 2012.
    doi:10.1093/nar/gks063
  3. The convergence of analytic high- equilibrium in a finite aspect ratio tokamak.
    R. Y. Neches, S. C. Cowley, P. A. Gourdain, and J. N. Leboeuf. Physics of Plasmas, 15(12):122504+, 2008.
    doi:10.1063/1.3008049
  4. Stability of highly shifted equilibria in a large aspect ratio low-field tokamak.
    P. A. Gourdain, J. N. Leboeuf, and R. Y. Neches. Physics of Plasmas, 14(11):112513+, 2007.
    doi:10.1063/1.2807024
  5. Stability of highly shifted equilibria in a Large-Aspect-ratio tokamak.
    P. A. Gourdain, S. C. Cowley, J. N. Leboeuf, and R. Y. Neches. Physical Review Letters, 97(5), August 2006.
    doi:10.1103/PhysRevLett.97.055003

Makers do not make weapons

Posted by Russell on December 17, 2012 at 6:58 p.m.
Last Tuesday, I started writing an article about Thing 11770 on Thingiverse, a MakerBot Industries for sharing 3D printable objects. Thing 11770 is a reinforced 3D printable lower receiver for an AR-15 assault rifle. This is the part of the gun that feeds bullets from the magazine into upper receiver, which handles the cycling of the spent round and the insertion of the new round. With the right combination of upper and lower receiver, fresh rounds are cycled into the weapon using a portion of the kinetic energy from firing the previous round. When the trigger is pulled, this process happens continuously, firing one bullet after another. That is what it means to be an "automatic" weapon. Thing 11770 is particularly interesting because, legally speaking, the lower receiver is the gun itself. It is the engine that makes the gun a gun, rather than a movie prop. And you can 3D print it. And it works.

At very the moment I was hemming and hawing over how to articulate my feelings about this development, someone used an AR-15 to murder twenty seven people, including twenty children, ages six and seven at Sandy Hook Elementary School. Now I know exactly how I feel.

I love 3D printing. I love the maker movement. I love the idea of people building home-brew versions of all sorts of devices, and inventing entirely new classes of devices. 3D printing has played, and will continue to play, an important role in that.

When I was fourteen, like many boys at that age, I thought missiles and fighter planes and tanks were pretty awesome. I read a lot of Tom Clancy books, and I indulged in my interest by dragging my family to the Wright Patterson Air Force Base Museum, the Smithsonian Air & Space Museum, the California Science Center’s Air & Space Museum, and the Intrepid Air, Sea & Space Museum. At Wright Patterson, I visited the F-117 Nighthawk as many times as I could. The author of Thing 11770 calls himself "Have Blue," the codename for the Nighthawk demonstrator aircraft.

When I was sixteen, I went to boarding school, where I learned vector calculus and farming. I learned how to grub potatoes out of the freezing ground in the driving rain, how to make maple syrup, how to lay in beets and squash and onions for the winter. I stood on a windy mountain top and learned how to find the orbital ephemera of a comet. I learned how to milk cows, how to care for cows when they are sick, and how to make the most delicious yogurt and mozzarella cheese you could possibly imagine. I learned how to repair a tractor engine with a mallet and a wrench. One freezing night, I found myself covered in blood and shit and urine and fear as I helped bring a new life gasping and staggering into the world.

Farming also means slaughtering and butchering. One morning, I walked into the barn. I was handed a weapon. I was asked to take a life.

I found that I could not.

Not ever.

The instant my shoulders took up the weight of the strange, snub nosed machine, it felt like the weight of the metal hung from my heart, stretching and distorting it. I wanted the weight of it to tear me apart, but I knew it was a weight I could carry, if I wanted to. I quietly handed the gun back to the farm manager, and walked out into the thawing snow, and spent the rest of the black pre-dawn puking into the mud behind the water tower.

Many people have wondered why I do not eat meat. This is why. For the rest of my life, I will feel the weight of that terrible little machine.

There are reasons to make, to have and to use guns. To defend your country, yes. To humanely put down an animal before butchering it, perhaps. For vainglory? For entertainment? No.

Tools are sacred things. We are a tool-using species; our tools are projections of our hopes and aspirations. When we are filled with joy, we pick up our tools and hammer the air into music. We need to understand and to be understood, and so we shape our voices into language. We send our tools delicately probing into the bodies of our loved ones, seeking out cancers and blood clots and infections. We invest huge amounts of effort building and maintaining tools that allow us to speak to one another across great distances. We hurl our tools across the void to other planets to satisfy our craving for knowledge. When we grieve, we take up our tools and carve the names of those we have lost into the living rock of our planet. Our tools are our souls. They are our defining characteristic. Love may be what makes us alive, but our tools are what make us human.

A gun is a tool. It is a simple tool. Any man or woman or child can use one. A gun is not much more complicated than a can opener, and not nearly as sophisticated as cordless screwdriver. Like all tools, a gun reveals something fundamental about its maker, its wielder and its abuser. This is true for all weapons.

As a strong supporter of the maker movement, of free and open source software, of open science, I want people to have as much freedom as possible to make and remake and experiment. I also believe very, very strongly in the responsibly we have to one another. I believe that we each have a responsibility not make things that hurt and kill and destroy.

I am not yet prepared to call for a law to prohibit Have Blue from posting functional 3D printable assault rifle parts on the internet. The law is a blunt instrument, and would cause a great deal of collateral damage. However, I am prepared to say that Have Blue is a fucking asshole. I am prepared to call Justin Halford, who created the original CNC model, a fucking asshole. I am prepared to say that anyone who considers themselves a "gun enthusiast" and is older than about sixteen needs to grow the fuck up. The maker community should not tolerate this behavior. Meditate on the meaning of the word antisocial for a moment. What could be more antisocial than gleefully proliferating machines whose principal function is murder?

The maker community should not tolerate these designs, or the ideas and opinions of their designers until they show evidence of behaving like adults. It's clear that the CNC Gunsmithing community has a lot of talented, clever people. It's clear from reading his blog that Have Blue is neither ignorant nor stupid.

So, I'm calling you folks out. There are twenty children dead in Connecticut. Their bodies were ripped apart by the very machines you are "democratizing." As far as I know, nobody has used your designs to kill anyone. If you continue down this path, some future version of Thing 11770 will be used to murder little children. It's just a matter of time, and probably a lot less time than you think. However, there is still time to take a stand. Do the right thing. Take down the designs. Apologize for what you've done. Find a new project. Use your talents for something good. This will not stop people from murdering children with 3D printed guns, but perhaps you can buy us some time before that day comes. You know that this is true.

If making home-brew assault rifles is really what you want to do, there is perhaps one venue where this might actually make sense. Freight your CNC machine to Istanbul, and smuggle it into Homs or Aleppo. Help the Free Syrian Army get rid of Bashar Assad. Oh wait, what’s that? You don't want to get shot? Fancy that.

It takes courage to admit you are wrong. Show us some courage.

Update : It appears that MakerBot has decided to remove Thing 11770 from Thingiverse. If you follow the link to the item, the files have been removed and a message says, "This Thing is currently under moderation for violating the Thingiverse Terms of Service. Files and images for this Thing are currently unavailable." I'm glad it's no longer up, but I am disappointed in how this was handled. I'm disappointed that MakerBot left it up for so long, but I'm also disappointed that Have Blue didn't just take it down himself.

A new Prometheus

Posted by Russell on December 08, 2012 at 2:33 a.m.
One year ago, UC Davis law student Megan Glanville was killed a stone's throw from my front door. She was crossing the street for a morning run. It was foggy. The driver didn't see her.

Since then, the intersection where she died has been redesigned. It is now a three-way stop with modern LED lighting. Watching over the scene, there is a new flashing red beacon.

This sort of infrastructure is easy to take for granted. As a Commissioner for the City of Davis, I suppose I pay closer attention to these things that most people do. I've payed particular attention to this little piece of city infrastructure because I pass through it several times a day.

Something has changed there since the red beacon went up. Up and down the boulevard, for almost a mile, there are crossings to access the bicycle path. Drivers now stop and let me cross. They never did that before. I am not exaggerating when I say that wherever the beacon's light falls, the feel of the street has changed. It's no longer the tail end of a lonely country road. It's a neighborhood street, and people act accordingly.

I would like to think that drivers feel the significance of the flashing beacon. I would like to think that they have noticed that the intersection has been redesigned. I would like to think that they know that Megan Glanville died there. In all likelihood, they are oblivious to these things. They stop and smile and waive me through anyway.

Why?

Good design matters. That's why.

The rocky ledge runs far into the sea,
And on its outer point, some miles away,
The Lighthouse lifts its massive masonry,
A pillar of fire by night, of cloud by day.

Even at this distance I can see the tides,
Upheaving, break unheard along its base,
A speechless wrath, that rises and subsides
In the white lip and tremor of the face.

And as the evening darkens, lo! how bright,
Through the deep purple of the twilight air,
Beams forth the sudden radiance of its light
With strange, unearthly splendor in the glare!

Not one alone; from each projecting cape
And perilous reef along the ocean's verge,
Starts into life a dim, gigantic shape,
Holding its lantern o'er the restless surge.

Like the great giant Christopher it stands
Upon the brink of the tempestuous wave,
Wading far out among the rocks and sands,
The night-o'ertaken mariner to save.

-- The Lighthouse, Henry Wadsworth Longfellow

On a superficial level, a flashing red beacon is a utilitarian thing. If you look more closely, you will see that it is also a thing of beauty. It is an avatar of the compulsion we all feel to protect, to warn, to guide. The humble beacon is one of the better angels of our nature, sculpted with massive limbs of galvanized steel and eyes of electrically exuberant gallium phosphide. It sends our message out into the world, again, and again, and again.

be careful

be careful

be careful

be careful

be careful

...

Why doesn't your lab have a 3D printer yet?

Posted by Russell on November 20, 2012 at 6:30 a.m.
Electrophoresis setups are like Tupperware. You can never find the right lid when you need it, and someone always seems to be borrowing the doohicky you need.

Here in the Eisen Lab, it turns out we've been using Marc Facciotti's electrophoresis stuff for years. He keeps his stuff organized, and, well... that's not been our strong suit lately. John, our lab manager, has been gently but inexorably herding us towards a semblance of respectability in our lab behavior. As part of this, he decided that it was time for us to get our electrophoresis stuff straightened out. So, he ordered a bunch nice of gel combs from one of our suppliers. They cost $51 each (see the "12 tooth double-sided comb", catalog number 669-B2-12, for the exact one pictured below). We bought six of them with different sizes and spacing, for a total exceeding $300.

While I appreciate that companies need to make money, this is a ridiculous price for a lousy little scrap of plastic. $300 for a couple of gel combs is cartel pricing, not market pricing. Fortunately, we happen to have a very nice 3D printer. It is very good at making little scraps of plastic. So, I busted out the calipers and tossed together some models of gel combs in OpenSCAD. A few minutes of printing later, and the $51 gel combs are heading back to the store.

Here's the code for the six well 1.5mm by 9mm comb :

f=0.01;
difference(){
  difference(){
    union(){
      cube( [ 80, 27, 3 ] );
      translate( [ 5.25, 14.3, f ] ) cube( [ 68, 9.3, 7.25 ] );
    }
    for ( i = [ 0:5 ] ) {
      translate( [ 17.1+i*11.0, -f, -f ] ) cube( [ 1.75, 12, 5 ] );
    }
  }
  union(){
    translate( [ -f,   -f, -f ] ) cube( [ 7,  12, 7] );
    translate( [ 73+f, -f, -f ] ) cube( [ 7,  12, 7] );
    translate( [ 0,    -f, 1.6] ) cube( [ 80, 12, 8] );
  }
}
Pretty easy to grasp, even if you've never seen SCAD before.

So, how much did this cost?

I ordered this plastic from ProtoParadigm at $42 for a kilogram. That's about four pennies a gram. Each of these gel combs cost about 21 cents to print. That's 1/243rd the price.

The 3D printer cost €1,194.00 ($1524.62), which is less than the laptop I use for most of my work. The savings on just these gel combs has recuperated 18% of the cost of the printer.

It's also important that I was able to make some minor improvements to the design. The printed combs fit into the gel mold a bit better than the "official" ones. I also made separate combs for the 1.0mm and 1.5mm versions, and the labels are easier to read. If I wanted, tiny tweaks to my SCAD file would let me make all sorts of fun combinations of thicknesses and widths that aren't available from the manufacturer. So, these gel combs are not only 1/243rd the price, but they are also better.

If you read the media hype about 3D printing, you will undoubtedly encounter a lot of fantastical-sounding speculation about how consumers will someday be able to print living goldfish, or computers, or bicycles. Maybe so. Maybe not. However, right now, you can print basic lab supplies and save a pile of money.

Buy your lab manager a little FDM printer and hook them up with some basic CAD training. Yes, the printer will probably mostly get used to make bottle openers and Tardis cookie cutters. So what? Your paper-printer, if you will excuse the retronym, mostly gets used for non-essential stuff too. I'd wager that for every important document printed in your lab, a hundred sheets have gone to Far Side cartoons and humorous notices taped up in the bathroom. It's a negligible expense compared to the benefits of having a machine that spits out documents when you really need them, and the social value of those the Far Side cartoons probably sums to a net positive anyway.

Conclusion : If you have a lab, and you don't have a 3D printer, you are wasting your money. Seriously.

In the time it took write this post, I printed $150 worth of gel combs, and it cost less than a cup of coffee.

Updates : Here is the tweet I originally posted about this article, before the URL for it vanishes into Twitter's memory hole. Here's an encouraging post from the Genome Web blog, and a nice article by Tim Dean at Australian Life Scientist. My article here seems to have spawned a thread on BioStar. Also, it made Ed Yong's Missing Links for November 24 over at Discover, and Megan Treacy did a really spiffy article over at Treehugger.

Many people have asked, and so I decided to see how well these kinds of 3D printed parts do in the autoclave. I tried it out with a couple of bad prints, and they seemed to hold up just fine after one or two cycles. Very thin parts did warp a bit, though, so I recommend printing parts you plan to autoclave nice and solid. Here is a before and after of a single-wall part (less than half a millimeter thick). I was expecting a puddle.

Journals are the problem and the solution

Posted by Russell on November 15, 2012 at 8:46 a.m.
Titus wrote an interesting post yesterday about addressing some of what I'll call structural problems in scientific research.
This is one of a bunch of posts on what I'm calling 'w4s' -- using the Web, and principles of the Web, to improve science. The others are:
  • The awesomeness we're experiencing, which provides some examples of current awesomeness in this area.
  • The challenges ahead, which covers some of the reasons why academia isn't moving very fast in this area.
  • Strategizing for the future, which talks about technical strategies and approaches for helping change things.
  • Tech wanted!, which gives some specific enabling technologies that I think are fairly easy to implement.
He goes on to throw some well-aimed brickbats at the system of publishing and grant reviewing, and how that plays out for researchers who actually do things other than crank out traditional research papers :
As an increasing amount of effort is put towards generating data sets and correlating across data sets, funding agencies are certainly trying to figure out how to reward such effort. The NSF is now explicitly allowing software and databases in the personnel BioSketches, for example, which is a great advance. Surely this is driving change?

The obstacle, unfortunately, may be the peer reviewer system. Most grants and papers are peer reviewed, and "peers" in this case include lots of professors that venerate PDFs and two-significant-digit Impact Factors. Moreover, many reviewers value theory over practice -- Fernando Perez has repeatedly ranted to me about his experience on serving on review panels for capacity-building cyberinfrastructure grants where most of the reviewers pay no attention whatsoever to the plans for software or data release, and even poo-poo those that have explicit plans. And if a grant gets trashed by the reviewers, it's very hard for the program manager to override that. The same thing occurs with software, where openness and replicability don't figure into the review much. So there's a big problem in getting grants and papers if you're distracting yourself by trying to be useful in addition to addressing novelty, impact, etc.

The career implications are that if you're stupid enough to make useful software and spend your time releasing useful data rather than writing papers, you can expect to be sidelined academically -- either because you won't get job offers, or because you won't get grants when you do have a job.

I propose a simple solution : Start better journals.

The fundamental unit of exchange in the academic reputation economy is the publication. At the moment, it is very hard to publish things that are not "normal" research papers. PLOS ONE has helped by shifting the review criteria towards correctness and leaving judgement of novelty to the community. However, PLOS ONE is still nevertheless an awkward place to publish a piece of software, for example.

Tool builders are expected to produce three publications for every one research result. First they have to design, assemble, test and publish the tool. Then they have to write a paper about the tool. Then they have to document the tool. After that, they are expected to release updates, patches and improvements. The only one of these items that "counts" in the academic sense is the one that generates a DOI number -- the paper. This is usually the least valuable of all the things produced. Honestly, how many of you BLAST users have actually read the BLAST paper?

What is needed are journals that let you publish things that aren't strictly papers. It seems perfectly reasonable that a panel of peers should be able review software on my GitHub account and bestow a DOI number on a tag they feel meets the criteria set by the editorial board that badgered them into participating in the review. It seems perfectly reasonable that when I cut a major update of the software, I might submit it for review. This would be extremely wonderful, as it would lead to reviews and critiques the code itself, which almost never happens when one submits an application note.

The same should apply to tool documentation. Science suffers a great deal because documentation is missing, poor, or out of date. The only way to fix that is to let tool builders have their tool documentation reviewed and published. Perhaps some journals might review code only, others documentation only, and others code and documentation together. The same goes for updates. If you want academics to do something, you have to provide rewards in the currency of academia.

It is also important not to overlook things beyond software. What about people building methods and protocols? There are already journals that publish methods papers, but a lot more could be done to make these publications more useful. JoVE, the Journal of Visualized Experiments, is a pretty interesting step in that direction, but much much more needs to be done. Most scientists have no experience whatsoever in video production, narration, editing, or any of the skills needed to make a really good JoVE publication.

There is also another big gap in instrumentation and hardware. Every really productive laboratory has at least one person who builds things. For example, at the UC Davis Genome Center perhaps a third of all the science we publish involve some gizmo built by our in-house machinist Steve Lucero. Steve is definitely what I would regard as a practicing researcher, and has been (ahem) instrumental in a number of important publications. Nevertheless, he was invited to be an author on his first publication only this year. By a graduate student. I don't think this is particularly malicious on the part of the laboratories that use his creations in their work. The problem is that there isn't really a good venue for publishing things.

Booting up new kinds of journals is a long-term endeavor. PLOS ONE is still struggling for acceptability in many circles. Nevertheless, getting researchers to actually look at each others' code would yield rewards in the short term while we wait for the resulting DOIs to be appreciated by the broader scientific community.

Trouble with SoftSerial on the Arduino Leonardo

Posted by Russell on May 25, 2012 at 12:05 p.m.
While I was wandering around at Maker Faire last weekend, I heard someone say, "Woah, is this the Leonardo?" And lo, there was a handful of Arduino Leonardo boards lined up on a shelf for sale. I instantly grabbed one, and bundled it home to play with it.

The Leonardo is Arduino's latest board, announced last September. It uses the Atmega32u4 chip, which has onboard USB. This has two important implications; first, the Leonardo costs less than the Uno, and second it will be able to operate in any USB mode. That means people can make Human Interface Devices (HID), like mice and keyboards and printers, with Arduino, and present themselves to the host using the standard USB interfaces for those devices. That means you can build things that don't need to talk via serial, and use the host's built-in drivers for mice and printers and whatnot. This is a big step forward for Open Hardware.

Anyway, I'm developing an little remote environmental data logger to use for part of my dissertation project, and I thought I'd see if I could use the Leonardo board in my design. I'm using the Arduino board to talk to an Atlas Scientific pH stamp, which communicates by serial. It works fine on the Uno with SoftwareSerial (formerly known as NewSoftSerial until it was beamed up into the Arduino Core mothership).

Unfortunately, it didn't go so well on the Leo. The board can send commands to the pH stamp, but doesn't receive anything. I swapped in an FTDI for the pH stamp, and confirmed that the Leonardo is indeed sending data, but it didn't seem to be able to receive any characters I sent back. I tried moving the rx line to each the digital pins, and had no luck. Here is my test program :

#include <SoftwareSerial.h>

#define rxPin 2
#define txPin 3

SoftwareSerial mySerial( rxPin, txPin );

byte i;
byte startup = 0;

void setup() {

  mySerial.begin( 38400  );
  Serial.begin(   9600   );
}

void loop() {
  
  if( startup == 0 ) {             // begin startup
    for( i = 1; i <= 2; i++ ) {
      delay( 1000 );
      mySerial.print( "l0\r" );    // turn the LED off
      delay( 1000 );
      mySerial.print( "l1\r" );    // turn the LED on
    }
    startup = 1;                   // don't re-enter
  }                                // end startup

  Serial.println( "taking reading..." );
  mySerial.print( "r\r" );
  delay(1000);
  
  Serial.println( mySerial.available() );
  
}
On the Uno, I see the number increasing as the read buffer fills up :
taking reading...
0
taking reading...
0
taking reading...
7
taking reading...
16
taking reading...
16
On the Leo, it seems that nothing ever gets added to the read buffer, no matter how any characters I send over from the FTDI or which pins I used for the rx line :
taking reading...
0
taking reading...
0
taking reading...
0
taking reading...
0
taking reading...
0
taking reading...
I really wanted to see if I was crazy here, but I'm one of the first people among the General Public to get their hands on a Leonardo board. So, I started talking with Ken Jordan on #arduino on Freenode (he goes by Xark) who has a similar board, the Atmega32u4 Breakout+. It's based on the same chip as the Leonardo, but it has different pinouts and a different bootloader. He flashed the Leonardo bootloder onto his board, and worked out the following pin mapping :
Arduino 1.0.1     Adafruit         ATMEL
digitalWrite pin  atmega32u4+ pin  AVR pin function(s)
----------------  ---------------  ------------------
D0                D2               PD2 (#INT2/RXD1)
D1                D3               PD3 (#INT3/TXD1)
D2                D1               PD1 (#INT1/SDA)
D3#               D0               PD0 (#INT0/OC0B)
D4/A6             D4               PD4 (ICP1/ADC8)
D5#               C6               PC6 (OC3A/#OC4A)
D6#/A7            D7               PD7 (T0/OC4D/ADC10)
D7                E6 (LED)         PE6 (INT6/AIN0)
D8/A8             B4               PB4 (PCINT4/ADC11)
D9#/A9            B5               PB5 (OC1A/PCINT5/#OC4B/ADC12)
D10#/A10          B6               PB6 (OC1B/PCINT6/OC4B/ADC13)
D11#              B7               PB7 (OC0A/OC1C/PCINT7/#RTS)
D12/A11           D6               PD6 (T1/#OC4D/ADC9)
D13#  (LED)       C7               PC7 (ICP3/CLK0/OC4A)
D14   (MISO)      B3               PB3 (PDO/MISO/PCINT3)
D15   (SCK)       B1               PB1 (SCLK/PCINT1)
D16   (MOSI)      B2               PB2 (PDI/MOSI/PCINT2)
D17   (RXLED)     B0               PB0 (SS/PCINT0)
D18/A0            F7               PF7 (ADC7/TDI)
D19/A1            F6               PF6 (ADC6/TDO)
D20/A2            F5               PF5 (ADC5/TMS)
D21/A3            F4               PF4 (ADC4/TCK)
D22/A4            F1               PF1 (ADC1)
D23/A5            F0               PF0 (ADC0)
-     (TXLED)     D5               PD5 (XCK1/#CTS)
-     (HWB)       -  (HWB)         PE2 (#HWB)
This was derived from the ATmega 32U4-Arduino Pin Mapping and ATMEL's datasheet for the ATmega32U4 chip. Once that was worked out, he flashed my test program onto his board, and also found that SoftwareSerial could transmit fine, but couldn't receive anything.

Ken rummaged around a little more, and had this to say :

The SoftSerial seems to use PCINT0-3 so there seems to me a minor problem in Leo-land in that only PCINT0 appears to be supported (and it is on "funky" output for RXLED). Hopefully I am just misunderstanding something (but it imay be the interrupt remap table is incorrect for Leo).
Then he disappeared for a little while, and came back with :
I have confirmed my suspicion. When I disassemble SoftSerial.cpp.o I can see that only __vector_9 is compiled (i.e., one of 4 #ifdefs for PCINT0-3) and the interrupt vector 10 is PCINT0 (0 is reset vector so offset by one makes sense). So, unless you hook serial to RXLED pin of CPU I don't believe it will work with the current libs.

Also I believe the Leo page is just wrong when it says pins 2 & 3 support pin change interrupts (I think this was copied from Uno but it is incorrect, the only (exposed) pins are D8 D9 D10 and D11 that support PCINT according to the ATMEL datasheet (and these are PCINT 4-7 not the ones in the interrupt mapping table AFAICT).

I believe this is where I can stop worrying that I'd be wasting the time of the core Arduino developers, and say quod erat demonstrandum; it a bug in SoftwareSerial. Hopefully they can update the Arduino IDE before the boards hits wider distribution.

Update : So, it turns out that this is a known limitation of the Leonardo. David Mellis looked into it, and left this comment :

You're right that the Leonardo only has one pin change interrupt, meaning that the software serial receive doesn't work on every pin. You should, however, be able to use pins 8 to 11 (inclusive) as receive pins for software serial. Additionally, the SPI pins (MISO, SCK, MOSI) available on the ICSP header and addressable from the Arduino software as pins 14, 15, and 16 should work.
He is, of course, correct. I'm not sure why my testing didn't work on pins 8-11, but they do indeed work fine. Unfortunately, this means that the Leonardo is not compatible with a number of cool shields. The Arduino SoftSerial Library Reference documentation has been updated with a more detailed list of limitations.

Moving forward by stopping

Posted by Russell on April 02, 2012 at 4:06 p.m.
Just a three weeks after I was sworn in for my term on the City of Davis Safety and Parking Advisory Commission, UC Davis law student Megan Glanville was killed just a few dozen feet from my doorstep. She was out jogging on a foggy morning, and truck coming into town from the county road ran her down in the crosswalk. I never knew Megan, but her death deeply upsets me.

I've been worrying about pedestrian and bike safety ever since my little sister was nearly killed by a careless driver.

I find it extremely frustrating that most people do not look beyond the (usually imagined) behavior of the people involved in an accident like the one that almost killed my sister, or that did kill Megan Glanville. Either they identify with the frustrating experience of driving, and blame the victim, or they side with the law, and place the responsibility at the feet of the operator of the more dangerous vehicle. I will always side with the person who suffered more, but both views are myopic. When someone has been killed in an accident, the question of who was more "right" in that sliver of time is irrelevant. It is worse than irrelevant; it is an insult to the lives of all the people affected.

There are other, far more urgent questions that need to be raised. If you see a problem, the first question you should always ask is, "In what way am I responsible for this?" We are all bound together by bonds of mutual responsibility, and nothing happens among people, good or bad, for which each of us are not in some sense responsible. That is what words like "society," "community," and "civilization" mean. They describe the fact that the bonds that link us together are fundamentally inescapable. There is such a thing as integrity, but there is no such thing as self-reliance. Interdependence is the very essence of what makes us human. And so, if you see something that upsets you, the first thing you should look at is your own role in causing it. Through our choices, we were all present on morning that George Souza killed Megan Glanville. You. Me. Everyone. We all had a hand in it.

Clearly, we failed. You failed. I failed. Someone is dead as a consequence of that failure.

So, let us set aside the choices of George Souza and Megan Glanville, and look at the choices we made that contributed to this terrible thing. They are easy enough to see :

This is the crosswalk where Megan was killed, which is part of a system of roads that belong to the City of Davis. The arrow on the yellow sign is pointing almost directly at the spot. The laws that govern the design of the road are a kaleidoscopic fugue of local, county, state, federal and international regulations. Within that often contradictory matrix of statutes, the city government has a small keyhole of authority within which it may choose what the road looks like and how it works.

From an engineering point of view, it's pretty clear what the problem is. The road on the left is just a stone's throw from the border of the city. Beyond the border, it is a wide county road that cuts a nearly straight line for miles among orchards and farms. When it crosses into the city, this road suddenly plunges into a dense residential neighborhood with no transition whatsoever. The intersection where Megan was killed is the very first intersection an eastbound driver encounters in the City of Davis. So, drivers come in from the county road going at county road speeds, and roar through this intersection where people are trying to cross to the bike path that parallels the road. Add a little darkness and bit of fog, and the accident was basically inevitable.

Why was this intersection designed this way? I don't know. According to the laws and statutes that regulate its engineering, there is nothing particularly wrong with it. But then again, houses that catch fire and burn people alive inside are often built to code. Compliance with the law is not enough. Only thoughtful design can keep people safe, and the absence of that thoughtfulness killed someone.

So, who is to blame? The legislators who wrote the statues describing how intersections should be designed? The engineers whose designs were constrained by those statutes? The City of Davis Public Works Department that built and maintained it? Surely, some of the responsibility falls to them. But not very much. If you've ever driven, walked or bicycled through the intersection of Lake and Russell, then a great deal of the responsibility falls on you. If you've ever felt uncomfortable or unsafe while passing through it, then you knew someone would get hurt there sooner or later.

The Council Chambers are open to the public. The meetings and agendas are available weeks in advance for all to see, at CityOfDavis.org. You can even submit your concerns in writing if you don't have time to come to the meetings. In other words, you had the reason and the means to get this fixed, or at least play a part in getting it fixed, before Megan Glanville was killed. I share in this responsibility; I serve on the commission charged with advising the City Council on these things, and I did not raise this issue either. And I use this intersection several times a day. And I always feel unsafe. It is my fault too.

So, here is what is going to happen. The City Council was asked, and agreed, to take steps to prevent anyone else from getting killed. The proposed changes will add stop signs on Russell Boulevard in both directions, a blinking red light in case drivers don't see the stop signs in the fog, and four new street lights for better illumination overall. It will cost about $20,000.

This is a much better design. It's impossible to know if it would have saved Megan's life had it been in place in December, but it seems likely that it would have. I strongly support it.

Roads are not natural phenomena. They are public infrastructure, and they are designed and built and maintained in exactly the way the public asks them to be. Let's try to do a better job of holding up our end of that conversation.

Time for Science!

Posted by Russell on March 04, 2012 at 4:13 p.m.
Now that I've passed my qualifying exam, it's time to do some Science!

Blogging my candidacy exam

Posted by Russell on March 04, 2012 at 4:02 p.m.
(This is cross-posted from a guest article I wrote on Jonathan's Blog last week. I thought it would be cool to have it on my own blog too.)

Because this seems to be my default mode of organizing my thoughts when it comes to research, I've decided to write my dissertation proposal as a blog post. This way, when I'm standing in front of my committee on Thursday, I can simply fall back on one my more more annoying habits; talking at length about something I wrote on my blog. Or, since he has graciously lent me his megaphone for the occasion, I can talk at length about something I wrote on Jonathan's blog.

Introduction : Seeking a microbial travelogue

Last summer, I had a lucky chance to travel to Kamchatka with Frank Robb and Albert Colman. It was a learning experience of epic proportions. Nevertheless, I came home with a puzzling question. As I continued to ponder it, the question went from puzzling to vexing to maddening, and eventually became an unhealthy obsession. In other words, a dissertation project. In the following paragraphs, I'm going to try to explain why this question is so interesting, and what I'm going to do to try answer it.

About a million years ago (the mid-Pleistocene), one of Kamchatka's many volcanoes erupted and collapsed into its magma chamber to form Uzon Caldera. The caldera floor is now a spectacular thermal field, and one of the most beautiful spots on the planet. I regularly read through Igor Shpilenok's Livejournal, where he posts incredible photographs of Uzon and the nature reserve that encompasses it. It's well worth bookmarking, even if you can't read Russian.

The thermal fields are covered in hot springs of many different sizes. Here's one of my favorites :

Each one of these is about the size of a bowl of soup. In some places the springs are so numerous that it is difficult to avoid stepping in them. You can tell just by looking at these three springs that the chemistry varies considerably; I'm given to understand that the different colors are due to the dominant oxidation species of sulfur, and the one on the far left was about thirty degrees hotter than the other two. All three of them are almost certainly colonized by fascinating microbes.

The experienced microbiologists on the expedition set about the business of pursuing questions like Who is there? and What are they doing? I was there to collect a few samples for metagenomic sequencing, and so my own work was completed on the first day. I spent the rest of my time there thinking about the microbes that live in these beautiful hotsprings, and wondering How did they get there?

Extremophiles are practically made-to-order for this question. The study of extremophile biology has been a bonanza for both applied and basic science. Extremophiles live differently, and their adaptations have taught us a lot about how evolution works, about the history of life on earth, about biochemistry, and all sorts of interesting things. However, their very peculiarity poses an interesting problem. Imagine you would freeze to death at 80° Celsius. How does the world look to you? Pretty inhospitable; a few little ponds of warmth dotted across vast deserts of freezing death.

Clearly, dispersal plays an essential role for the survival and evolution of these organisms, yet we know almost nothing about how they do it. The model of microbial dispersal that has reigned supreme in microbiology since it was first proposed in 1934 is Lourens Baas Becking's, "alles is overal: maar het milieu selecteert" (everything is everywhere, but the environment selects). This is a profound idea; it asserts that microbial dispersal is effectively infinite, and that differences in the composition of microbial communities is due to selection alone. The phenomenon of sites that seem identical but have different communities is explained as a failure to understand and measure their selective properties well enough.

This model has been a powerful tool for microbiology, and much of what we know about cellular metabolism has been learned by the careful tinkering with selective growth media it exhorts one to conduct. Nevertheless, the Baas Becking model just doesn't seem reasonable. Microbes do not disperse among the continents by quantum teleportation; they must face barriers and obstacles, some perhaps insurmountable, as well as conduits and highways. Even with their rapid growth and vast numbers, this landscape of barriers and conduits must influence their spread around the world.

Ecologists have known for a very long time that these barriers and conduits are crucial evolutionary mechanisms. Evolution can be seen as an ainteraction of two processes; mutation and selection. The nature of the interaction is determined by the structure of the population in which they occur. This structure is determined by biological processes such as sexual mechanisms and recombination, which are in turn is determined chiefly by the population's distribution in space and its migration in that space.

As any sports fan knows, the structure of a tournament can be more important than the outcome of any particular game, or even the rules of the game. This is true for life, too. From one generation to the next, genes are shuffled and reshuffled through the population, and the way the population is compartmentalized sets the broad outlines of this process.

A monolithic population -- one in which all players are in the same compartment -- evolves differently than a fragmented population, even if mutation, recombination and selection pressures are identical. And so, if we want to understand the evolution of microbes, we need to know something about this structure. Bass Becking's hypothesis is a statement about the nature of this structure, specifically, that the structure is monolithic. If true, it means that the only difference between an Erlenmeyer flask and the entire planet is the number of unique niches. The difference in size would be irrelevant.

This is a pretty strange thing to claim. And yet, the Baas Becking model has proved surprisingly difficult to knock down. For as long as microbiologists have been systematically classifying microbes, whenever they've found similar environments, they've found basically the same microbes. Baas Becking proposed his hypothesis in an environment of overwhelming evidence.

However, as molecular techniques have allowed researchers to probe deeper into the life and times of microbes (and every other living thing), some cracks have started to show. Rachel Whitaker and Thane Papke have challenged the Bass Becking model by looking at the biogeography of thermophilic microbes (such as Sulfolobus islan and Oscillatoria amphigranulata), first by 16S rRNA phylogenetics and later using high resolution, multi-locus methods. Both Rachel's work and Papke's work, as well as many studies of disease evolution, very clearly show that when you look within a microbial species, the populations do not appear quite so cosmopolitan. While Sulfolobus islandicus is found in hot springs all over the world, the evolutionary distance between each pair of its isolates is strongly correlated with the geographic distance between their sources. So, these microbes are indeed getting around the planet, but if we look at their DNA, we see that they are not getting around so quickly.

However, Baas Becking has an answer for this; "...but the environment selects." What if the variation is due to selection acting at a finer scale? It's well established that species sorting effects play a major role in determining the composition of microbial communities at the species level. There is no particular reason to believe that this effect does not apply at smaller phylogenetic scales. The work with Sulfolobus islandicus attempts to control for this by choosing isolates from hot springs with similar physical and chemical properties, but unfortunately there is no such thing as a pair of identical hot springs. Just walk the boardwalks in Yellowstone, and you'll see what I mean. The differences among the sites from which these microbes were isolated can always be offered as an alternative explanation to dispersal. Even if you crank those differences down to nearly zero, one can always suggest that perhaps there is a difference that we don't know about that happened to be important.

This is why the Baas Becking hypothesis is so hard to refute: One must simultaneously establish that there is a non-uniform phylogeographic distribution, and that this non-uniformity is not due to selection-driven effects such as species sorting or local adaptive selection. To do this, we need a methodology that allows us to simultaneously measure phylogeography and selection.

There are a variety of ways of measuring selection. Jonathan's Evolution textbook has a whole chapter about it. I'll go into a bit more detail in Aim 3, but for now, I'd just like to draw attention to the fact that the effect of selection does not typically fall uniformly across a genome. This non-uniformity tends to leave a characteristic signature in the nucleotide composition of a population. Selective sweeps and bottlenecks, for example, are usually identified by examining how a population's nucleotide diversity varies over its genome.

For certain measures of selection (e.g., linkage disequilibrium) one can design a set of marker genes that could be used to assay the relative effect of selection among populations. This could then extend the single species, multi-locus phylogenetic methods that have already been used to measure the biogeography of microbes to include information about selection. This could, in principle, allow one to simultaneously refute "everything is everywhere..." and "...but the environment selects." However, designing and testing all those markers, ordering all those primers and doing all those PCR reactions would be a drag. If selection turned out to work a little differently than initially imagined, the data would be useless.

But, these are microbes, after all. If I've learned anything from Jonathan, it's that there is very little to be gained by avoiding sequencing.

We're getting better and better at sequencing new genomes, but it is not a trivial undertaking. However, re-sequencing genomes is becoming routine enough it's replacing microarray analysis for many applications. The most difficult part of re-sequencing an isolate is growing the isolate. Fortunately, re-sequencing is particularly well suited for culture-independent approaches. As long as we have complete genomes for the organisms we're interested in, we can build metagenomes from environmental samples using our favorite second-generation sequencing platform. Then we simply map the reads to the reference genomes. The workflow is a bit like ChIP-seq, except without culturing anything and without the ChIP. We go directly from the environmental sample to sequencing to read-mapping. Maybe we can call it Eco-seq? That sounds catchy.

Not only is the whole-genome approach better, but with the right tools, it is easier and cheaper that multi-locus methods, and allows one to include many species simultaneously. The data will do beautifully for phylogeography, and have the added benefit that we can recapitulate the multi-locus methodology by throwing away data, rather collecting more.

To implement this, I have divided my project into three main steps :

  • Aim 1 : Develop a biogeographical sampling strategy to optimize representation of a natural microbial community
  • Aim 2 : Develop an apply techniques for broad matagenomic sampling, metadata collection and data processing
  • Aim 3 : Test the dispersal hypothesis using a phylogeographic model with controls for local selection
But, before I get into the implementation, I should pause for a moment and make sure I've stated my hypothesis perfectly clearly : I think that dispersal plays a major role in establishing the composition of microbial communities. The Baas Becking hypothesis doesn't deny that dispersal happens, in fact, it asserts that dispersal is infinite, but that it is selection, not dispersal, that ultimately determines which microbes are found in any particular place. If I find instead that dispersal itself plays a major role in determining community composition, then the world is a very different place to be a microbe.

Aim 1 : Develop a biogeographical sampling strategy to optimize the representation of a complete natural community

While I would love to keep visiting places like Kamchatka and Yellowstone, I've decided to study the biogeography of halophiles, specifically in California and neighboring states. Firstly, because I can drive and hike to most of the places were they grow. Secondly, because the places where halophiles like to grow tend to be much easier to get permission to sample from. Some of them are industrial waste sites; no worry about disturbing fragile habitats. Thirdly, because our lab has been heavily involved in sequencing halophile genomes, which are necessary component of my approach. There is also a fourth reason, but I'm saving it for the Epilogue.

As I have written about before, the US Geological Survey has built a massive catalog of hydrological features across the Western United States. It's as complete a list of the substantial, persistent halophile habitats one could possibly wish for. It has almost two thousand possible sites in California, Nevada and Oregon alone :


USGS survey sites. UC Davis is marked with a red star.

The database is complete enough that we can get a pretty good sense of what the distribution of sites looks like within this region just by looking at the map. The sites are basically coincident with mountain ranges. Even though they aren't depicted, the Coastal Range, the Sierras, the Cascades and the Rockies all stand out. This isn't surprising; salt lakes require some sort of constraining geographic topology, or the natural drainage would simply carry the salt into the ocean. Interestingly, hot springs are also usually found in mountains (some of these sites are indeed hot springs), but that has less to do with the mountains themselves as it does with the processes that built mountains. To put it more pithily, you find salt lakes where there are mountains, but you find mountains where there are hot springs.

This database obviously contains too many sites to visit. It took Dr. Mariner's team forty years to gather all of this information. I need to choose from among these sites. But which ones? Is there a way to know if I'm making good selections? Does it even matter?

As it turns out, it does matter. When we talk about dispersal in the context of biogeography, we are making a statement about the way organisms get from place to place. Usually, we expect to see a distance decay relationship, because we expect that more distant places are harder to get to, and thus the rates of dispersal across longer distances should be lower. I need to be reasonably confident that I will see the same distance-decay relationship within the sub-sample that I would have seen for every site in the database. This doesn't necessarily mean that the microbes will obey this relationship, but if they do, I need data that would support the measurement.

There is a pretty straightforward way of doing this. If we take every pair of sites in the database, calculate the Great Circle distance between them, and then sort these distances, we can get spectrum of pairwise distances. Here's what that looks like for the sites in my chunk of the USGS database :


The spectrum of pairwise distances among all sites in the USGS databse (solid black), among randomly placed sites over the same geographic area (dashed black), and among random sub-sample of 360 sites from the database (solid red).

I've plotted three spectra here. The dashed black line is what you'd get if the sites had been randomly distributed over the same geographic area, and the solid black line is the spectra of the actual pairwise distances. As you can see, the distribution is highly non-random, but we already knew this just by glancing at the map. The red line is the spectrum of a random sub-sample of 360 sites from the database (I chose 360 because that is about how many samples I could collect in five one-week road trips).

This sub-sample matches the spectrum of the database pretty well, but not perfectly. It's easy to generate candidate sub-samples, and they can be scored by how closely their spectra match the database. I'd like to minimize the amount of time it takes me to finish my dissertation, which I expect will be somewhat related to the number of samples I collect. There is a cute little optimization problem there.

Although I've outlined the field work, laboratory work and analysis as separate steps, these things will actually take place simultaneously. After I return from the field with the first batch of samples, I will process and submit them for sequencing before going on the next collection trip. I can dispatch the analysis pipeline from pretty much anywhere (even with my mobile phone). That's why I've set aside sample selection and collection as a separate aim. The sample selection process determines where to start, how to proceed, and when I'm done.

Aim 2 : Develop an apply techniques for broad matagenomic sampling, metadata collection and data processing

In order to build all these genomes, I need to solve some technical problems. Building this many metagenomes is a pretty new thing, and so some of the tools I need did not exist in a form (or at a cost) that is useful to me. So, I've developed or adapted some new tools to bring the effort, cost and time for large-scale comparative metagenomics into the realm of a dissertation project.

There are four technical challenges :

  • Quickly collect a large number of samples and transport them to the laboratory without degradation.
  • Build several hundred sequencing libraries.
  • Collect high-quality metadata describing the sites.
  • Assemble thousands of re-sequenced genomes.
To solve each of these problems, I've applied exactly the same principle : Simplify and parallelize. I can't claim credit for the idea here, because I was raised on it. Literally.

Sample collection protocol

When I first joined Jonathan's lab, Jenna Morgan (if you're looking for her newer papers, make sure to add "Lang," as she's since gotten married) was testing how well metagenomic sequencing actually represents the target environment. In her paper, now out in PLoS ONE, one of the key findings is that mechanical disruption is essential.

I learned during my trip to Kamchatka that getting samples back to the lab without degradation is very hard, and it really would be best to do the DNA extraction immediately. Unfortunately, another lesson I learned in Kamchatka is that it is surprisingly difficult to do molecular biology in the woods. One of the ways I helped out while I was there was to kill mosquitoes trying to bite our lab technician so she wouldn't have to swat them with her gloved hands. It's not easy to do this without making an aerosol of bug guts and blood over the open spin columns.

So, I was very excited when I went to ASM last year, and encountered a cool idea from Zymo Research. Basically, it's a battery-operated bead mill, and a combined stabilization and cell lysis buffer. This solves the transportation problem and the bead-beating problem, without the need to do any fiddly pipetting and centrifuging in the field. Also, it looks cool.

Unfortunately, the nylon screw threads on the sample processor tend to get gummed up with dirt, so I've designed my own attachment that uses a quick-release style fitting instead of a screw top.

It's called the Smash-o-Tron 3000, and you can download it on Thingiverse.

Sequencing library construction

The next technical problem is actually building the sequencing libraries. Potentially, there could be a lot of them, especially if I do replicates. If I were to collect three biological replicates from every site on the map, I would have to create about six thousand metagenomes. I will not be collecting anywhere close to six thousand samples, but I thought it was an interesting technical problem. So I solved it.

Well, actually I added some mechanization to a solution Epicentre (now part of Illumina) marketed, and my lab-mates Aaron Darling and Qingyi Zhang have refined into a dirt-cheap multiplexed sequencing solution. The standard technique for building Illumina sequencing libraries involves mechanically shearing the source DNA, ligating barcode sequences and sequencing adapters to the fragments, mixing them all together, and then doing size selection and cleanup. The first two steps of this process are fairly tedious and expensive. As it turns out, Tn5 transposase can be used to fragment the DNA and ligate the barcodes and adapters in one easy digest. Qingyi is now growing huge quantities of the stuff.

The trouble is that DNA extraction yields an unpredictable amount of DNA, and the activity of Tn5 is sensitive to the concentration of target DNA. So, before you can start the Tn5 digest, you have to dilute the raw DNA to the right concentration and aliquat the correct amount for the reaction. This isn't a big deal if you have a dozen samples. If you have thousands, the dilutions become the rate limiting step. If I'm the one doing the dilutions, it becomes a show-stopper at around a hundred samples. I'm just not that good at pipetting. (Seriously.)

The usual way of dealing with this problem is to use a liquid handling robot. Unfortunately, liquid handling robots are stupendously expensive. Even at their considerable expense, many of them are shockingly slow.

To efficiently process a large number of samples, we need to be able to treat every sample exactly the same. This way, can bang through the whole protocol with a multichannel pipetter. It occurred to me that many companies sell DNA extraction kits that use spin columns embedded in 96-well plates, and we have a swinging bucket centrifuge with a rotor that accommodates four plates at a time. So, the DNA extraction step is easy to parallelize. The Tn5 digests work just fine in 96-well plates.

We happen to have (well, actually Marc's lab has) a fluorometer that handles 96-well plates. Once the DNA extraction is finished, I can use a multichannel pipetter to make aliquats from the raw DNA, and measure the DNA yield for each sample in parallel. So far, so good.

Now, to dilute the raw DNA to the right concentration for the Tn5 digest, I need to put an equal volume of raw DNA into differing amounts of water. This violates the principle of treating every sample the same, which means I can't use a multichannel pipetter to get the job done. That is, unless I have a 96-well plate that looks like this :


Programmatically generated dilution plate CAD model

I wrote a piece of software that takes a table of concentration measurements from the fluorometer, and designs a 96-well plate with wells of the correct volume to dilute each sample to the right concentration for the Tn5 digest. If I make one of these plates for each batch of 96 samples, I can use a multichannel pipetter throughout.

Of course, unless you are Kevin Flynn, you can't actually pipette liquids into a 3D computer model and achieve the desired effect. To convert the model from bits into atoms, I ordered a 3D printer kit from Ultimaker. (I love working in this lab!)


The Ultimaker kit

After three days of intense and highly entertaining fiddling around, I managed to get the kit assembled. A few more days of experimentation yielded my first successful prints (a couple of whistles). A few days after that, I was starting my first attempts to build my calibrated volume dilution plates.


Dawei Lin and his daughter waiting for their whistle (thing 1046) to finish printing.

Learning about 3D printing has been an adventure, but I've got the basics down and I'm now refining the process. I'm now printing plates with surprisingly good quality. I've had some help from the Ultimaker community on this, particularly from Florian Horsch.

Much to my embarrassment, the first (very lousy) prototype of my calibrated volume dilution plate ended up on AggieTV. Fortunately, the glare from the window made it look much more awesome than it actual was.

The upshot is that if I needed to make ten or twenty thousand metagenomes, I could do it. I can print twelve 96-well dilution plates overnight. Working at a leisurely pace, these would allow me to make 1152 metagenome libraries in about two afternoons' worth of work.

I'm pretty excited about this idea, and there are a lot of different directions one could take it. The College of Engineering here at UC Davis is letting me teach a class this quarter that I've decided to call "Robotics for Laboratory Applications," where we'll be exploring ways to apply this technology to molecular biology, genomics and ecology. Eight really bright UC Davis undergraduates have signed up (along with the director of the Genome Center's Bioinformatics Core), and I'm very excited to see what they'll do!

Environmental metadata collection

To help me sanity check the selection measurement, I decided that I wanted to have detailed measurements of environmental differences among sample sites. Water chemistry, temperature, weather, and variability of these are known to select for or against various species of microbes. The USGS database has extremely detailed measurements of all of these things, all the way down to the isotopic level. However, I still need to take my own measurements to confirm that the site hasn't changed since it was visited by the USGS team, and to get some idea of what the variability of these parameters might be. It would also be nice if I could retrieve the data remotely, and not have to make return trips to every site.

Unfortunately, these products are are extraordinarily expensive. The ones that can be left in the field for a few months to log data cost even more. The ones that can transmit the data wirelessly are so expensive that I'd only be able to afford a handful if I blew an entire R01 grant on them.

This bothers me on a moral level. The key components are a few probes, a little lithium polymer battery, a solar panel the size of your hand, and a cell phone. You can buy them separately for maybe fifty bucks, plus the probes. Buying them as an integrated environmental data monitoring solution costs tens of thousands of dollars per unit. A nice one, with weather monitoring, backup batteries and a good enclosure could cost a hundred thousand dollars. You can make whatever apology you like on behalf of the industry, but the fact is that massive overcharging for simple electronics is preventing science from getting done.

So, I ordered a couple of Arduino boards and made my own.


My prototype Arduino-based environmental data logger. This version has a pH probe, Flash storage, and a Bluetooth interface.

The idea is to walk into the field with a data logger and a stick. Then I will find a suitable rock. Then I will pound the stick into the mud with the rock. Then I will strap the data logger to the stick, and leave it there while I go about the business of collecting samples. To keep it safe from the elements, the electronics will be entombedin a protective wad of silicone elastomer with a little solar panel and a battery.

The bill of materials for one of these data loggers is about $200, and so I won't feel too bad about simply leaving them there to collect data. If the site has cell phone service, I will add a GSM modem to the datalogger (I like the LinkSprite SM5100B with SparkFun's GSM shield), and transmit the data to my server at UC Davis through an SMS gateway. Then I don't have to go back to the site to collect the data. This could easily save $200 worth of gasoline. I'll put a pre-paid return shipping labels on them so that they can find their way home someday. I'm eagerly looking forward to decades of calls from Jonathan complaining about my old grimy data loggers showing up in his mail.

From the water, the data logger can measure pH, dissolved oxygen, oxidation/reduction potential, conductivity (from which salinity can be calculated), and temperature. I may also add a small weather station to record air temperature, precipitation, wind speed and direction, and solar radiation. I doubt if all of these parameters will be useful, but the additional instrumentation is not very expensive.

Assembling the genomes

The final technical hurdle is assembling genomes from the metagenomic data. If I have 360 sites and 100 reference genomes, I'm going to have to assemble 36,000 genomes. Happily, I am really re-sequencing them, which is much, much easier than de novo sequencing. Nevertheless, 36,000 is still a lot of genomes.

For each metagenome, I must :

  • Remove adapter contamination with TagDust
  • Trim reads for quality, discard low quality reads
  • Remove PCR duplicates
  • Map reads to references with bwa, bowtie, SHRiMP, or whatever
This yields a BAM file for each metagenome, each representing an alignment of reads to each scaffold of each reference genome. All of the reference genomes can be placed into a single FASTA file with a consistent naming scheme for distinguishing among scaffolds belonging to different organisms. A hundred-odd archaeal reference genomes is about 200-400 megabases, or an order of magnitude smaller than the human genome. Using the Burrows-Wheeler Aligner on a reasonably modern computer, this takes just a few minutes for each metagenome.

I'm impatient, though, and so I applied for (and received) an AWS in Education grant. Then I wrote a script that parcels each metagenome off to a virtual machine image, and then unleashes all of them simultaneously on Amazon.com's thundering heard of rental computers. Once they finish their alignment, each virtual machine stores the BAM file in my Dropbox account and shuts down. The going rate for an EC2 Extra Large instance is $0.68 per hour.

This approach could be used for any re-sequencing project, including ChIP-seq, RNA-seq, SNP analysis, and many others.

Aim 3 : Test the dispersal hypothesis using a phylogeographic model with controls for local selection

In order to test my hypothesis, I need to model the dispersal of organisms among the sites. However, in order to do a proper job of this, I need to make sure I'm not conflating dispersal and selective effects in the data used to initialize the model. There are three steps :
  • Identify genomic regions that have recently been under selection
  • Build genome trees with those regions masked out
  • Model dispersal among the sites
In all three cases, there are a large number of methods to choose from.

One way of detecting the effects of selection is Tajima's D. This measures deviation from the neutral model by comparing two estimators of the neutral genetic variation, one based on the nucleotide diversity and one based on the number of polymorphic sites. Neutral theory predicts that the two estimators are equal, and so genomic regions in which these two estimators are not equal are evolving in a way that is not predicted by the neutral model (i.e., they are under some kind of selection). One can do this calculation on a sliding window to measure Tajima's D for each coordinate of each the genome of each organism. As it turns out, this exact approach was used by David Begun's lab to study the distribution of selection across the Drosophilia genome.

I will delete the regions of the genomes that deviate significantly (say, by more than one standard deviation) from neutral. Then I'll make whole genome alignments, and build a phylogenetic trees for each organism. This tree would contain only characters that (at least insofar as you believe Tajima's D and Wu and Fey's FST) are evolving neutrally, and are not under selection.

A phylogenetic tree represents evolutionary events that have taken place over time. In order to infer the dispersal of the represented organisms, would need model where those events took place. Again, there are a variety of methods for doing this, and but my personal favorite is probably the approach used by Isabel Sanmartín for modeling dispersal of invertebrates among the Canary Islands. I don't know if this is necessarily the best method, but I like the idea that the DNA model and the dispersal model use the same mathematics, and are computed together. Basically, they allowed each taxa to evolve its own DNA model, but constrained by the requirement that they share a common dispersal model. Then they did Markov Chain Monte Carlo (MCMC) sampling of the posterior distributions of island model parameters (using MrBayes 4.0).

According to Wikipedia, the most respected and widely consulted authority on this and every topic, the General Time Reversible Model it is the most generalized model describing the rates at which one nucleotide replaces another. If we want to know the rate at which a thymine turns into a guanine, we look at elment (2,3) of this matrix :

πG is the stationary state frequency for guanine, and rTG is the exchangability rate between from T to G. However, if we think of this a little differently, as Sanmartín suggests in her paper, we can use the GTR model for the dispersal of species among sites (or islands). If we want to know the rate at which a species migrates from island B to island C, we look in cell (2,3) of a very similar matrix :

Here, πC is the relative carrying capacity of island C, and rBC is the relative dispersal rate from island B to island C. Thus, the total dispersal from island i to island j is

dij = Nπirijπjm

where N is the total number of species in the system, and m is the group-specific dispersal rate. This might look something like this :

One nifty thing I discovered about MrBayes is that it can link against the BEAGLE library, which can accelerate these calculations using GPU clusters. Suspiciously, Aaron Darling is one of the authors. If you were looking for evidence that the Eisen Lab is a den of Bayesians, this would be it.

This brings us, at last, back to the hypothesis and Baas Becking. Here we have a phylogeographic model of dispersal among sites within a metacommunity, with the effects of selection removed. If the model predicts well-supported finite rates of dispersal within the metacommunity, my hypothesis is sustained. If not, then Baas Becking's 78 year reign continues.

Epilogue : Lourens Baas Becking, the man verses the strawman


Lourens Baas Becking

Microbiologists have been taking potshots at the Baas Becking hypothesis for a decade or two now, and I am no exception. I'm certainly hoping that the study I've outlined here will be the fatal blow.

However, it's important to recognize that we've been a bit unfair to Baas Becking himself. The hypothesis that carries his name is a model, and Baas Becking himself fully understood that dispersal must play an important role in community formation. He understood perfectly well that "alles is overal: maar het milieu selecteert" was not literally true; it is only mostly true, and then only in the context of the observational methodology available at the time. In 1934, in the same book where he proposed his eponymous hypothesis, he observed that there are some habitats that were ideally suited for one microbe or another, and yet these microbes were not present. He offered the following explanation: "There thus are rare and less rare microbes. Perhaps there are very rare microbes, i.e., microbes whose possibility of dispersion is limited for whatever reason."

Useful models are never "true" in the usual sense of the word. Models like the Baas Becking hypothesis divide the world into distinct intellectual habitats; one in which the model holds, and one in which it doesn't. At the shore between the two habitats, there is an intellectual littoral zone; a place where the model gives way, and something else rises up. As any naturalist knows, most of the action happens at interfaces; land and sea, sea and air, sea and mud, forest and prairie. The principle applies just as well to the landscape of ideas. The limits of a model, especially one as sweeping as Baas Becking's, provides a lot of cozy little tidal ponds for graduate students to scuttle around in.

By the way, guess where Lourens Baas Becking first developed his hypothesis? He was here in California, studying the halopiles of the local salt lakes. In fact, the very ones I will be studying.

The Dover Train

Posted by Russell on February 14, 2012 at 4:47 a.m.
Well, it's Valentine's Day again. For all you lucky folks who have someone from whom deserts may be extorted, cheers!

As for me, I'm writing this post for the girl on the Dover train who gave me a funny look. Um... Hi.

Don't know if this will work, but stranger things have happened.

Happy 60th, Mom and Dad!

Posted by Russell on February 10, 2012 at 2:24 p.m.
As is often the case, odd people had odd children. Readers of this blog have no doubt long noted a certain... peculiarity of the author, and hypothesized about the individuals who raised me. I can proudly confirm that they are every bit as odd as I am. Anyway, they both turned sixty in the last couple of weeks (my mom in December, and my dad a few days ago), and I wanted to post a little celebration of our great family tradition of crossgrainedness.

For my mom's birthday, she and my sister came over and slept on the floor of my apartment in Davis, despite the availability of perfectly comfortable and reasonably priced lodgings downtown. For her birthday, we found a fetid puddle of water near Lake Berryessa with some tadpoles in it. She was delighted.

For my dad's birthday, he's celebrating his election to the National Academy of Engineering (the sister organization to the Institute of Medicine. He also got this birthday card from his longtime college friend Bruce Reznick :


Bruce is a professor of mathematics at the University of Illinois. He studies the identities of high-order polynomials. So, this really is the a birthday card only he would think to send.

The moral imperative for Open Science

Posted by Russell on February 09, 2012 at 2:41 a.m.
So, there is this law in Congress called the Research Works Act. If enacted, it would prohibit open access mandates by federal granting agencies. It would end the policy that NIH-funded research be deposited in PubMed, and it would prevent other agencies from establishing such policies. It is a bad idea for a lot of reasons. If you want a elegant dissection of the reasons why the Research Works Act is a bad idea, I suggest Michael Eisen's many posts on the topic.

There is now an effort to boycott Elsevier, the authors and primary proponents of the Research Works Act. I signed the pledge, though unfortunately my name doesn't carry much weight. Last week, my advisor got a little worked up about it, and suggested that scientists should perhaps ignore papers published by Elsevier, and then changed his mind about it after some cogent arguments were raised.

It won't serve the progress of science to ignore new discoveries because we don't like the journals they were published in. However, I do not believe that this point, however cogent, is enough to carry the day. He wasn't suggesting that we ignore the discovery, but rather to ignore the publication. We can, and should, treat publications in closed access journals as illegitimate claims to the scientific record.

I was a little puzzled at first that Jonathan didn't make this point. After all, Michael and Jonathan are often called Open Access stormtroopers. But then I remembered that, despite their passion, storming and trooping are not really in their natures. They lack the necessary highhanded arrogance for those activities. As a physicist who jumped into biology late in my education, it's often been pointed out to me that there is nothing so noxiously arrogant as a physicist moonlighting as a biologist. I try very hard not to be "that guy," but I still get the occasional eye roll. So, just for this occasion, I'm going to uncork a little physicist's swagger by framing the need for Open Access scientific publication as a moral absolute.

Whenever something is unclear, the physicist in me always looks at two things. First, I look at the asymptotic behavior (the extremes), and then I look at simplified models that match the asymptotic behavior. Then I check to see if I've got the right model by looking at how it scales and generalizes to the full problem.

On the continuum of open to closed access publishing, the asymptotic behavior in the closed-access direction is simply not publishing a finding at all. In this case, the moral reasoning is simple (that is not to say universally agreed upon, but simple nevertheless). Take the invention of Calculus, for example. Leibniz, not Newton, was the one who did the work, took the risks, and invested time and effort to bring Calculus to the world. In my opinion, this is what matters in terms of establishing precedence. The more one examines Newton's behavior, the more one wishes to credit Leibniz. I am willing to take the plunge and assert that the precise chronology is irrelevant to the question of apportioning credit. What is relevant is the work of pedagogy.

Publishing in a closed-access journal is secret-keeping. It keeps the information confined among a certain group of people. Combined with copyright, it is a life-destroying secret to anyone who shares it without permission. I think it would be fair to weight the amount of credit according to the extent to which the discovery was shared.

Now I'm going to resort to another irritating behavior typical of physicists; I shall reduce a complicated, nuanced situation to a Gedankenexperiment preserving only the essential features, and then extrapolate the results back to the real world.

Suppose you are making soup for dinner, and you discover that a quart of bleach has somehow spilled into the soup. You immediately tell your family that the soup is poisoned. Nobody eats the soup. Dinner is ruined, but everyone is safe. This is what a normal person would do.

Now let's look at the other extreme. Suppose you noticed soup was poisoned, but you kept it to yourself. You watch your family eat the soup, and they get sick. Only a very, very bad person would do this.

We have a sort of emotional model that lets us make a moral judgement about the behavior of the discoverer in this situation. It's easy to make a moral judgement about the extremes, which is why we looked at them. Now, let's look at the in-between situation.

Suppose instead of announcing the discovery, you tell your son that you know something very important. You demand that he give you something precious in order for you to tell him what it is. Then, after taking away one of his favorite toys, you whisper your discovery about the soup into his ear. Then you tell him he mustn't tell anyone, or he will be in very big trouble. So much trouble that you will take all his toys away and never speak to him again. Then you let your spouse and daughter eat the soup, and they get sick.

The in-between behavior is more unethical than the "bad" extreme! Yes, it's better that one fewer person is hurt, but that is a statement about the outcome, not about the behavior of the discoverer. Selecting the in-between behavior just as callous, but adds cruelty and selfishness.

If you behaved this way, it is clear you would not deserve full credit for your discovery. At most, you could claim one third of the possible credit for your discovery because you only shared the knowledge with one third of the people who stood to be affected by it. Most people would give you much less credit than that. We have many pungent words for people who behave like this which I shall not enumerate.

This scenario is exactly equivalent to publishing in a closed access journal. An author cannot excuse themselves by drawing a distinction between the practices of the journal and their own practices and wishes; by choosing a journal, the author chooses that journal's behavior. There are hundreds of journals with a rich spectrum of behaviors ranging from upstanding and public-spirited to cynical and predatory. Through your choice of journal, you must own that journal's behavior.

Science is a universal human enterprise. When an important discovery is made, it eventually touches the lives of every singe human being. If you keep a discovery secret from anyone, you are behaving reprehensibly. It is only fair that your credit and reputation should suffer as a consequence. It is only fair for other scientists to question the legitimacy of your claim to the credit.

The simple and appropriate punishment for keeping secrets is to always treat the first openly available paper as the actual record of discovery. The fact that someone else may have discovered it first, and kept it secret, is a technicality of interest only to historians. This is what science has always done. I am merely suggesting that we regard secrecy on a sliding scale, and to take into account the role that science plays in the world.

What scientists, especially American scientists, need to begin doing is to take a more pragmatic view of what constitutes a secret. What fraction of human beings on Earth have access to Elsevier's catalog? One in a thousand? One in a hundred thousand? One in a million?

The problem isn't the cost. It's the behavior. If you told both of your children about the poisoned soup, but not your spouse, you'd still be an asshole. If you decreased the number of toys that needed to be sacrificed to have access to the discovery, you'd still be an asshole. If you relaxed the punishment for sharing the secret discovery, you'd still be an asshole. If you shared only a summary of your discovery (e.g., 'some of the food in this house has been poisoned'), you'd still be an asshole.

There is one, and only one ethical way to handle a discovery, and that is to share it freely.

Ultimaker EM leakage

Posted by Russell on February 01, 2012 at 4:06 p.m.
Steven Lucero, the machinist for Biomedical Engineering, just finished building his own (well, the college's) Ultimaker 3D printer. BME is in the process of setting up a pretty awesome rapid prototyping facility, with an Objet Eden 260, a MakerBot and now an Ultimaker. To go with the 3D printers, Steven is also setting up a little electronics lab to go with it. A few weeks ago, he asked me for a shopping list of items that would be useful for electronics hacking, which I was delighted to provide.

One of the things I had to put on my shopping list for Steven was a basic oscilloscope. It's amazing how useful these things are. I've wanted my own o-scope for a long time, and so I happened to have a bunch of low-cost o-scopes bookmarked. Steven ended up buying exactly the one I would have bought for myself, which is sold by Sparkfun (they're sold out right now, unfortunately).

I wanted to see if I liked the software, so while Steven was printing something on his Ultimaker, I put two of the probes next to the X and Y stepper motors to measure the EM leakage.

Like most modern digital oscilloscopes, you can freeze the trace, and save the data as a CSV file onto a USB key. So, here's what the EM leakage from the stepper motors looks like during a print :

Cool, huh?

Teaching, week 2

Posted by Russell on January 28, 2012 at 1:50 a.m.
For reasons I don't fully comprehend myself, I decided it would be perfectly normal and reasonable to invent a class in a peculiar new topic, and then try to convince the University to let me offer it as a course. To my surprise (and horror), they let me do it. Thus was born Robotics for Laboratory Applications, under the auspices of UC Davis Biomedical Engineering and the good graces of Marc Facciotti.

Seven students signed up. Two of them I already knew because were on the UC Davis iGEM team, which shared our laboratory space during the year they worked on the project that won them Best Foundational Advance. I'm still getting to know the other five, but so far I'm impressed with them. UC Davis has some pretty brilliant undergraduates.

This is my first time teaching in an official (although perhaps not quite formal) capacity, and it's kind of interesting to see how things look from the other side. When a professor distributes a handout, for example, it doesn't seem like a big deal. However, it's kind of surprising how long it takes to print, collate and staple seven copies of everything. I definitely underestimated that today, and barely had their safety information sheets and IT policy documents ready in time. OK, I didn't have them ready in time, but fortunately one of the students hadn't finished eating his lunch, and this gave me an excuse to disappear for a minute.

The purpose of the class is to design a "minimally invasive" extension for our 3D printer that will allow us to use it as a general purpose laboratory robot. Friday's class was devoted to narrowing down the scope of the project to focus on a single function. We kicked around a lot of cool ideas, but didn't quite settle on a single one yet. I've set next Friday as the deadline for reaching a consensus.

One of the functions we might implement is a pipetting robot. We were wondering how well this would work. Just to illustrate the idea, I suggested they just give it a try.

Yes, that is just a pipetter taped to the hot end of our 3D printer. With two pieces of masking tape. To our surprise, I was able to maneuver the pipetter into a tip, seat the tip and position it over a small bottle-cap full of water. Operating the plunger manually, it worked.

We were not at all expecting to be able to get a good seal between the pipetter and the tip, but it worked just fine. I tried it a couple of times after the class, with different tips and pipetters, and didn't have any problem. Very encouraging, in terms of feasibility.

Cat replenishment

Posted by Russell on January 22, 2012 at 3:45 p.m.
I hear the internet is running low on pictures of adorable cats. It's raining outside in Davis today. Buzz seems to be hoping that I'll put down the camera and stop playing with ISO settings, and rub his belly. Either that, or he's mugging for the camera. It's hard to tell.

That is all.

Say it with us : Another open letter to the Chancellor

Posted by Russell on November 23, 2011 at 2:05 a.m.
Dear Chancellor Katehi,

I know this joins a growing list of open letters addressed to you, but you will find that this one really is addressed to you, rather than at you.

On Saturday, I signed the petition for your resignation. After this evening's townhall meeting, I withdrew my signature. You've restored some of my confidence in your ability to lead this campus, although reservations remain. The way I see it, you have two choices; lead, or resign. I would prefer you that lead.

Unfortunately, it seems that you are not getting the best advice in that regard. I offer these thoughts in the hope that they will point the way.

Sometimes, it is necessary to break a small rule in order to protect a more important rule. Civil disobedience is not disregard for rules in general; it is a statement about the relative importance of two rules that are, or have become contradictory. The Civil Rights rights movement broke many local ordinances and state laws, but this was done in order to push the country into compliance with the Fifth and Fourteenth amendments of the United States Constitution. This is a proud and honorable part of American history, and has been a model for tremendous positive change around the world.

The Occupy protests belong to this tradition; they are peacefully but deliberately breaking a small law, in this case, ordinances against camping, in order to protect the country from the existential threat of economic nihilism. UC Davis was occupied by its students because they object to its destruction.

You spoke powerfully this evening about the burning of universities and libraries in Greece. "No one has the right to destroy the public's property," is how I think you put it. I am absolutely in agreement. I believe it is indeed your duty as chancellor to protect this campus, because there are indeed anarchists who are very eager to burn it down. However, the anarchists who threaten UC Davis are not camping on the quad tonight. They are in Sacramento and Washington D.C.

One of the most difficult problems in politics is building coalitions. You are always divided from your natural allies by social boundaries. Race, religion, age, region, class and gender create boundaries to mutual comprehension. Professors are separated from students by the roles each must play in the classroom, and administrators are separated from both professors and students by billowing layers of university bureaucracy.

You have fought for this campus in Sacramento and Washington, and you have seen just how frustrating and lonely it is to fight for public education these days. You clearly understand how important places like UC Davis are for the future of this country. But on Friday, your officers used chemical weapons on people who were engaged in the very same fight.

So, let me make a suggestion. Don't just apologize. Don't just seek to heal and muddle forward. The panels, investigations, reports and meetings you discussed this evening are all important positive things, and by all means proceed with them. However, you must know that they will not save this campus from the fire that is coming.

Instead, look across the divide and recognize Occupy UC Davis for what it is; the banner of your true allies. They are the infantry in the battle to save public education. Join them. Next time you walk the halls of Congress to fight for this campus, don't just bring a few token students. Bring an army.

The past few days have made it painfully clear that while you can be quite articulate, you are not a skilled politician or tactician. This sits in stark contrast to the students, who have frankly run circles around you. If you're willing to fight for us, your errors can and will be forgiven. However, if you are going to be an effective advocate for this campus, you will need to employ the skills you have, and find trustworthy friends to help when you are out of your element. An alliance of the Chancellor's office and the student movement would be much greater than the sum of its parts, and would certainly be more productive than continuing to antagonize one another. If you want that alliance, you are going to have ask for it in the language of mass protest; with symbols, not words.

You will find that there is plenty of room on the quad for another tent. There could be no symbol more unambiguous than joining the students in committing this trivial infraction. The world is watching.

Whose university? Our university. Say it with us, Chancellor.

Russell Neches
Graduate student, Microbiology
UC Davis

These are not the microbes you are looking for

Posted by Russell on October 04, 2011 at 6:45 p.m.
A few months ago, I tweeted, "I've been working in a microbiology lab for two years, and just realized we don't actually have a microscope. Huh."

Jack Gilbert and some other people proceeded to give me grief for what I intended as an interesting observation about the current state of the art in microbiology. So, I decided to remedy the situation. Evidently, we do have a microscope, I just didn't know where it was.

Here are some cool things I found by randomly poking around in some of my samples from Borax Lake. This first thing I found is probably some kind of diatom from in the sediment of the little hot spring just north of Borax Lake. I'm not looking for diatoms, but it looks really, really cool.

Here they are at 100x magnification.

This is somewhat less cool-looking, but is probably what I'm actually looking for. In the little bubble of water surrounding the granule in the center, there were a couple little rods hopping around. No clue what they are, they're there, doing what they do.

3D printing update

Posted by Russell on October 04, 2011 at 12:19 a.m.
I've been working a bit on the software that generates my 96-well dilution plate. I have a new version that cuts the plastic use by about 80% and print time by about the same. Also, it now prints with the wells upside-down on the build platform, which should help cut down contamination during the printing process.

Things to do :

  • I'm going to try cutting the plastic use even more by adding a skirt around the plate (like a normal titer plate), and adjusting the outer height of each well.
  • Add a fill-line to each well.
  • Raise the well edges a little more, and add drain-holes between wells to prevent spillage between wells and to make filling easier.
  • Add embossed row and column labels.
  • Add an embossed text area for user notations (e.g., for which sample group is this plate calibrated).
Hmm. I might pull this off yet.

Also, if you are interested in this stuff, the UC Davis Biomedical Engineering made me instructor of a variable unit class (graded P/NP) called "Research internship in robotics for the laboratory" for Winter 2012. Sign up for BIM192, sec 2 (the CRN is 24791).

Borax Lake : Sample collection and processing

Posted by Russell on October 01, 2011 at 1:57 a.m.
I've admired Rosie Redfield's lab-notebook-as-blog from the moment I started reading it, and I've been looking for an excuse to steal pilfer abscond with adapt her idea. However, most of the work I've been doing up to this point has been computational, and try as I might, I can't make myself keep a lab notebook for programming. That's what things like GitHub are for. I've started actually doing some of the laboratory and field work for my thesis project, and so I finally have an excuse to do some open lab and field notebook blogging.

Rosie might be amused to that I'm starting off with some work I'm doing at an arsenic-heavy lake, although Borax Lake is known more for boron than arsenic. If I bugger up my assays, I just hope she'll get on my case in the comments before I submit anything for publication.

I will write more about this as I go along, but my goal for my thesis project is to try to get an idea about the modality of microbial migration. Specifically, I want to know if microbial taxa, when they colonize a new environment, arrive individually or as an existing consortium. I hope to find out by reconstructing population structures from metagenomic samples from widely dispersed but ecologically similar environments.

I learned about Borax Lake from Robert Mariner of the US Geological Survey, who was kind enough to respond to my emails and patiently discuss his survey results over the course of several lengthy telephone calls. He also volunteered a lot of useful information, such as which sites have rattlesnakes and where they are likely to be found, and helped enormously in search and selection of sampling sites. Without this help, I probably would have had to give up on this project as I originally imagined it.

Borax Lake was one of many thousands of sites across the American West surveyed over a 40 year long project USGS project led by Ivan Barnes and Robert Mariner to study the chemistry and isotopic composition of mineral springs. Extensive analysis of Borax Lake water was conducted by in August of 1972 by John Rapp, and again in July of 1991.

Dr. Mariner pointed out that Borax Lake is administered by the Nature Conservancy, and a little bit of Googleing and emailing got me in touch with Jay Kerby, the Southeast Oregon Project Manager for the Nature Conservancy. Jay was very helpful, and walked me through the process of obtaining sampling permits for my project.

Before I talk about Borax Lake, I need to say that it is absolutely essential that you obtain explicit, written permission before collecting samples. As scientists, we've got to get this stuff right if we want to avoid stuff like this. The fact that some researchers did not (for whatever reason) obtain permission to use the cells they used to make important discoveries, or did not cooperate in good faith with the originators of those cell lines, has made it much more difficult for me to do my own research. Kary Mullis, if you're reading this, thanks for PCR (really), but...

Anyway, I'm not sure if Borax Lake itself is going to be a good candidate for my project (it has very unique chemistry), but it is surrounded by ephemeral pools of brine that may be good analogs to coastal salt ponds. You could think think of this as island biogeography, but inverted; I'm looking for islands of ocean isolated by oceans of land.

The lake itself has a very peculiar mineralized ledge a few inches above the shore. The water has been precipitating an extremely hard material for a very long time. I tried to collect a small amount of it to examine in the lab, and discovered that it is as hard as concrete. Even with the aid of a hammer, I couldn't dislodge any small pieces. I didn't want to damage the ledge itself by taking a larger piece, so I left without any samples of the precipitated material. Borax Lake is sitting atop a thirty foot high pedestal of this stuff.

The Nature Conservancy has been working on some plans to make the site more accessible, but I don't imagine it will get many visitors. It is way off the beaten path. Next time I visit, I'm going to bring a truck. The lake is off of a very lonely state road, up several miles on unpaved, unmarked fire roads, followed by a few miles of ATV tracks. A horse would probably the the ideal way of getting there, but my trusty little Toyota still managed.

This is one of the hotsprings just north of Borax Lake. The first record I have of it is from May 1957 by D.E. White of the USGS. It was visited again in June 1973 by Robert Mariner, and again in September 1976 by Robert Mariner and Bill Evans. The next visit was in July 1991 by Robert Mariner. I measured a surface temperature of 65°C. To my surprise, I saw a couple of Borax Lake chubb swimming around near the cooler (but not much cooler) periphery.

I took four kinds of samples : Unprocessed water samples in 500ml bottles, unprocessed sediment samples in 50ml conical tubes, processed water samples for environmental DNA in Sterivex filters, and processed sediment samples for environmental DNA using Zymo's Xpedition Soil/Fecal miniprep kits. I divided the unprocessed samples between the freezer and the 37° room, and I'll save my notes on the filtered water samples for another article.

One of the unusual things about the Xpedition miniprep kit is that the first spin column is not a DNA binding column; it's more like a crap-catcher. So, you are supposed to keep the flow-through, not discard it as you would with a DNA binding column. John got a little ahead of himself, and discarded the flow-through from four columns before he realized the protocol was different from, well, just about all of the other DNA extraction mini-preps on the market. Fortunately, I collected many extra samples. Also, when I split the work between John and myself, I split up the samples into evens and odds, so that neither of us would be working on all of one group of replicates.

This led to an important lesson : Do not discard the lysis tubes after you've removed the supernatant. It occurred to me that the wreckage of beads, muck and buffer at the bottom of the spent tubes was probably full of DNA, so I added 500 μL of molecular-grade water, vortexed them, and put them back into the centrifuge at 10,000g for a minute, and spun the supernatant through the orange-capped columns. Two of the four yielded plenty of DNA. I'd probably have gotten more if I'd used lysis buffer instead of water, and the bead-beater instead of the vortexer.

I'm still not totally sure what rationale to apply for the last step. The Xpedition miniprep lets you elute the DNA with anywhere from 10 to 100 μL of buffer. If you use less elution buffer, you get less total DNA, but the DNA you get will be at higher concentration. Elute with more, and you get more DNA, but at lower concentration. The actual amount of DNA can vary over four orders of magnitude, and so guessing right is very helpful. But... impossible. I decided to elute in 50 μL, and that seems to have worked OK for my purposes.

I then measured the DNA concentration in a Qubit fluorometer with Invitrogen's Quant-iT high sensitivity assay for dsDNA. Because this requires me to go one-by-one, this is not how I would like to quantify my samples in the future. But, for thirty seven samples, it was easy enough.

Sample μg/mL Source Description
1 0.723 Don Edwards Wildlife Refuge Salt crystals from site A23
2 0.582 Don Edwards Wildlife Refuge Salt crystals from site A23
3 0.531 Don Edwards Wildlife Refuge Salt crystals from site A23
4 0.824 Don Edwards Wildlife Refuge Salt crystals from site A23
5 0.209 Don Edwards Wildlife Refuge Salt crystals from site A23
6 27.8 Don Edwards Wildlife Refuge Mat community from site A23
7 - Don Edwards Wildlife Refuge Mat community from site A23 (field processing failed)
8 2.57 Borax Lake Sediment (poor collection)
9 44.9 Borax Lake Sediment
10 44.9 Borax Lake Sediment
11 25.1 Borax Lake Sediment
12 47.1 Borax Lake Sediment
13 48.2 Borax Lake Sediment
14 41.2 Borax Lake Sediment
15 41.2 Borax Lake Sediment
16 40.9 Borax Lake Sediment
17 26.1 Borax Lake Sediment
18 31.6 Borax Lake Sediment
19 - Borax Lake Sediment (lost during extraction)
20 81.6 Borax Lake Sediment
21 35.6 Borax Lake Sediment
22 35.9 Borax Lake Sediment
23 - Borax Lake Mat community from hot spring
24 - Borax Lake Mat community from hot spring
25 3.13 Borax Lake Mat community from hot spring
26 44.0 Borax Lake Mat community from hot spring
27 - Borax Lake Mat community from hot spring (salvaged sample)
28 - Borax Lake Mat community from hot spring
29 2.76 Borax Lake Mat community from hot spring (salvaged sample)
30 - Borax Lake Mat community from hot spring
31 - Borax Lake Mat community from hot spring (salvaged sample)
32 - Borax Lake Mat community from hot spring
33 0.72 Borax Lake Mineralized mat community from hot spring
34 22.8 Borax Lake Mineralized mat community from hot spring
35 100 Borax Lake Mineralized mat community from hot spring
36 29.2 Borax Lake Mineralized mat community from hot spring
37 39.2 Borax Lake Mineralized mat community from hot spring (salvaged sample)

For the 19 samples that had DNA concentrations above about 20 μg/mL, I ran a gel to check the size distribution. It looks like the Zymo miniprep performed about as well as they claimed; most of the fragments seem to be between 5 and 10 kilobases, with a fair amount of DNA in fragments larger than 10 kilobases.

I only need about a picogram of input DNA for each transposase tagmentation library, and I only need fragments bigger than about 3 kilobases. So, this process exceeds my absurdly modest requirements by a lot.

I should mention that Anna-Louise Reysenbach graciously lent me a pH probe to use in the field after mine turned out to be dead as a doornail. Issac Wagner, a postdoc in her lab, spent a couple of hours helping me get their field probe calibrated with my meter. Unfortunately, their probe turned out to be in only somewhat better condition than mine, and Anna-Louise asked that I leave it in Portland rather than risk taking bad data with it. I drove directly from Borax Lake to the UC Davis Genome Center in about seven hours, and immediately took the chemical measurements on our benchtop pH meter. It didn't work out, but I still greatly appreciate the help from Anna-Louise and Issac! (Also, thanks goes to my little sister Anna, who has to take Portland's MAX over to Portland State to return the ailing pH probe.)

Spoon to Bench: A field DNA processing gadget review

Posted by Russell on September 30, 2011 at 1:24 a.m.
In my previous article, I outlined my plans for sequencing a very large number of metagenomes. Assuming that works, there also the problem of actually getting the samples in the first place. Aaron Darling likes to begin the story of metagenomics by saying, "It all begins with a spoon..."

So, how do you get the microbes from the spoon to the laboratory?

One of the things I learned from my experience in Kamchatka was just how tricky collecting samples in the field really is. From lining up permissions and paperwork, to dealing with cantankerous Customs officials, to avoiding getting mauled by bears, the trip from the spoon to the bench is fraught with difficulties. If you mess it up, you either don't get to do any science or you'll end up doing science on spoiled samples.

And then there is the DNA extraction. My lab mate Jenna published a paper last year where she created synthetic communities from cultured cells, and then examined how closely metagenomic sequencing reproduced that community. She found that the community representation was heavily skewed, but that the DNA extraction methodology was critically important. Because it was very difficult to know how well the extraction process was going to work on hot spring sediment, Albert Colman's group basically brought every DNA extraction kit they could lay hands on to Kamchatka. Also, they brought a whole lab with them; a 900-watt BioSpec bead beater (that almost killed our generator), a centrifuge, mini-fuge, a brace of pipetters, gloves, tips, tubes, tube racks, and a lab technician to run the show (see my Uzon Day Four post to see a little of that; also, most of the of heavy crates in the photos).

Albert, Bo and Sarah really did an excellent job pulling all of this together, but it was hard. Watching them (and helping them where I could) got me to think very carefully about how I want to conduct my field research. One thing is for sure; as much as I respect our BioSpec bead beater, I am not going to carry it into the field. Period. In fact, if I can possibly manage it, I am going to restrict my supplies and equipment to what I can carry in a daypack.

I'm still working on how I will do water sampling, but I think I might have found a solution to sediment sampling at the ASM meeting in New Orleans. Zymo Research just came out with a line of field DNA extraction kits that are intended specifically for field collection. The idea is pretty straight-forward; they combined a DNA stabilization buffer with a cell lysis buffer, and made a portable, battery-operated bead beater to go with it.

It's super cool, but I hemmed and hawed for a few months after ASM. I was a little suspicious of my own judgement; the system includes a cool gadget, and so of course I wanted it. I spent a month reading protocols and tinkering around before I finally decided that if the system works the way Zymo claims, it's just about the best thing for my purposes. What clinched it was re-reading Jenna's paper, which clearly shows the importance of thorough cell disruption.

So, I finally decided that I had to give it a try, and that's what this article is about. If you like, you can think of it as a parody of the tedious gadget reviews on Gizmodo and Engadget, with maybe a dollop or two of Anandtech's penchant for brain-liquefying detail.

I guess this wouldn't be proper gadget review unless I started with a meticulous series of photos documenting the unboxing. So, uh, here are the boxes.

The big one contains the sample processor, and the two smaller ones contain 50 DNA extraction mini-preps each. I'm going to leave the mini-prep kits sealed for now, since I'm going to use them for my field work. Zymo provides two DNA extraction mini-kits with the sample processor, so I'm going to use those to test out the system.

Underneath the documentation (directions are for suckers) and the mini-kits, there is the sample processor, a charging station, a 12 volt lithium ion battery pack, and an international power adapter. They also provide some little disks, which I think are for using with conical tubes (they recommend using skirted tubes, since conical tubes can shatter), and a couple of pairs of earplugs.

The earplugs turned out to be... prescient.

The sample processor itself is an modified Craftsman Hammerhead Auto Hammer. Upside? I can buy extra batteries from Sears! Downside? Seeing the $71.99 pricetag from Sears really makes Zymo's $900 pricetag hurt. Our super-powerful bench-top BioSpec bead beater is only about twice that.

When I asked, Zymo said that they've actually modified some of the internals of the Crafstman tool, but this might have just been to discourage me from traipsing off to the hardware store to buy some PVC pipe fittings and a hacksaw. Experience tells me, though, that I could easily fritter away $800 worth of time replicating their engineering. OK, $700. It's a really nice international power adapter.

I was a little disappointed to note that the Craftsman part is made in China. Not that I have anything against things being made in China, but I was under the impression that Craftsman was an American brand. It's a little like discovering that a jar of authentic-seeming salsa is made in New Jersey, or something. I'm sure they make perfectly good salsa in New Jersey. Nevertheless, I have a deep-seated belief that salsa should be made in a Southwestern state by grandmothers who each know five hundred thousand unique salsa recipes, and Craftsman tools should be made in Pennsylvania or West Virginia by guys who wear blue overalls and carry their lunches in pails.

OK, so maybe I do have something against everything being manufactured in China. While using the sample processor in the lab, it suddenly made a very loud click that I hadn't heard before. When I looked carefully, I noticed that there was a piece of metal debris caught in the motor vent. It seems to be made out of aluminum (it's not ferromagnetic). My guess is that this is debris from the manufacturing process, not a broken part of the device. I shook out two other smaller pieces, but lost them before I could photograph them. It looks like the three pieces are part of a square. Most likely this is the remains of an improperly handled punch-out, like a metal version of a paper chad. As you can see, it got kicked around inside the motor housing until it was ejected into the vent. I think Craftsman (or their subcontractor) should get the blame for this, rather than Zymo.

Here is the soil/fecal mini-kit. Each prep uses three sets of spin columns. The bead bashing tubes, as they are labeled, are in the upper right, along with two tubes of lysis/stabilization buffer and a tube of elution buffer.

The protocol says to add the sample first, and then add 750ml of lysis/stabilization buffer, and then bead-beat. But... then you would have to bring a p1000 and tips along with you. No thanks. The sample tubes and the beads had better be chemically stable, or they'd wreck everything. So, I aliquated the buffer into the bead tubes before leaving the lab, and left the p1000 behind. Zymo includes some very fancy spin columns with this kit; they have their own caps, and little nubs on the flowthrough channels that you need to snap off before you use the columns. I've not encountered anything quite like these.

The final step of the kit includes these green-capped columns that are pre-filled with buffer. I wasn't expecting any liquid to be in them, and so of course I spilled the first one on my foot. Don't do that.

So, I took a little miniature field expedition to the exotic environs of the Putah Creek Riparian Reserve to try this out. It didn't take long to find a place that promised to have plenty of microbes.

Here's a soil sample before processing.

I processed some of these samples for 45 seconds (the directions recommend a minimum of 30 seconds). Usually it seems to work fine, but occasionally the tube explodes and splatters mud and buffer all over the inside of the lysis chamber.

The exploding tube problem appears be caused by grit preventing the threads from closing correctly. In other words, it was my fault. Be extra careful to get the dirt actually inside the tube. Here's what it's supposed to look like.

After processing, the samples are noticeably warm. If you are going to process for much longer than 45 seconds, I suggest you stop and let the sample cool for a few minutes before continuing.

Here are the yields I measured for the mini-kit preps (minus the tube that exploded), eluted into 100 μL of buffer.

Source Yield
Potted plant 80.6 μg/mL
River muck 0.669 μg/mL
River muck 1.13 μg/mL
River muck 0.595 μg/mL
I messed up the extraction protocol a little bit (and I used too much elution buffer at the end), but still got enough DNA to work with. Not too shabby for a first try.

I decided I had to throw these samples and DNA away because I don't actually have permission to use samples collected on UC Davis's campus. That's also why I'm not showing a gel.

How to sequence 10,000 metagenomes with a 3D printer

Posted by Russell on September 19, 2011 at 1:15 a.m.
For my thesis project, one of the things I would like to do is sequence many different samples, perhaps on the order of several hundred or thousand. It's easy enough to build sequencing libraries these days, at least, with Illumina, anyway. Obviously, doing a couple of hundred lanes of Illumina sequencing would be ridiculous (not even Jonathan Eisen is that nice to his graduate students), and so I'll be using several barcoded samples pooled into each lane. The barcoding chemistry itself was fairly tedious, until people starting doing transposon-based library construction.

A transposon is a little piece of DNA that copies itself around inside the genome of an organism, via an enzyme called transposase. Here's what the genetic element looks like :

Transposase binds the element at the inverted repeats on either end, and coils it into a loop. Then it cuts the DNA at the inverted repeats, and the complex floats away. It leaves complementary overhanging ends in the chromosome, which are usually repaired by DNA polymerase and DNA ligase (DNA gets broken surprisingly frequently in the normal workaday life of a cell; that's why DNA repair mechanisms are so important). When it's complexed to DNA, transposase grabs the DNA like this :

The transposase we're using (Tn5) is a homodimer; the two subunits are in dark and light blue. The inverted repeats (red) are bound to the complex at the interfaces between the subunits. The pink loop is the DNA that gets cut and pasted.

The complex then floats around in the cell until the transposase recognizes an integration site somewhere else in the genome. It then cleaves the DNA and inserts the payload into the break. DNA ligase then comes along and fixes the backbones. You can see why this kind of transposon is also called a cut-and-paste transposon.

The reason these are interesting for library construction is that you can prepare a transposon complex where the loop of payload DNA is broken. When the transposon integrates, it pastes in a gap. If you add a lot of transposons that aren't too choosy about their binding sits, they will chop up your target DNA. Fragmentation is one of the steps needed for sequencing library construction. What's nice about transposons is that when you use them to chop up your target DNA, they leave the two halves of their payload stuck onto the ends.

If you stuck your sequencing adapters on there, the fragmentation process also includes adapter ligation. If you added barcodes along with the sequencing adapters, the reaction combines almost all of the library construction into a single digest. Epicentre whimsically named this process "tagmentation." Get it?

However, there's still a fly in this ointment. The distribution of transposon insertions is a function of the relative concentrations of charged transposon complexes to target DNA, and DNA extraction, even from seemingly identical samples, can have highly variable yields. So, it's very important to control the input concentrations and reaction volumes during the digest. This is fairly easy if you're only making a dozen or so libraries, but what if you want to make ten thousand of them?

Measuring DNA concentrations of lots of samples is relatively easy, and there are lots of ways of doing it. We have a plate reader that can do this by florescence on titer plates with 1534 wells, or we could (ab)use the qPCR machine to give us DNA concentrations on 384 well titer plates. There are other ways, too.

However you quantify the DNA concentrations, you have to dilute each sample to the desired concentration before you can start the tagmentation process. If you get the concentrations wrong, the library comes out funny.

A few dozen library constructions calls for hours of tedious work at the bench. I've gotten better at wetlab stuff since my first rotation, and the transposon-based library construction helps a lot, but staking my Ph.D. on reliably powering through lots of molecular biology would be a bad idea. Some people might not blink an eye at this, but as soon as I find myself repeating something four or five times, my computer science upbringing starts whispering there has got to be a better way in my ear. And lo, there is indeed a better way.

Hundreds or thousands of library constructions would call for a robotic liquid handling machine. I spent some time researching these things, and I'm not impressed. The hardware is nice, but programming the protocols involves wading into a morass of crumbling, poorly maintained closed source software, expensive vendor support contracts, and a lot of debugging and down-time. Oh, and they're terrifyingly expensive, and can be kind of dangerous.

Dispensing water into titer plates doesn't seem like a very challenging robotics application, so I thought about building my own robot. It would probably be about the same amount of work as ordering, programming and debugging one of the commercial robots, and it would be more fun.

But, robots are just such a mainframe-ish solution. If there is one thing my dad taught me, it's that a lot of little machines working in concert will beat the stuffing out of a single big machine. The trick is figuring out how to organize and coordinate lots of little machines. The key to this problem is to do lots and lots of little reactions in parallel; the coordination requires lots of precise dilutions simultaneously. Getting this part right would crack the whole thing wide open, allowing you to easily do more reactions than you probably even want.

So. I'm going to make my own custom microtiter plates, just for the dilution. This satisfies the coordination criteria, and allows me to treat a plate-load of reactions identically. If each well has the right volume for the dilution, I can just fill all the wells up to the top, pipette in the same volume of raw DNA with a multichannel pipetter, let the DNA mix a little, and all the wells will be at equal concentration. Then I pipette that into the tagmentation reaction, and I'm done. With a good multichannel pipetter, I can do 384 reactions about as easily as I could do one.

All that's necessary is a 3D printer, and the ability to procedurally generate CAD/CAM files from the measured DNA concentrations. As it happens, this is really easy, thanks to a little Python library called SolidPython :

These are the wells of a 96-well plate with randomly chosen volumes for reach well.

One of the things I'm worried about is contamination. 3D printers are not really designed for making sterile parts. So, what I've done here is design a mold, and I'm going to cast the plate itself in PDMS silicone elastomer. PDMS is easy to cast, and it has the nice property of being extremely durable once it's set. And, even better, when exposed to UV, the surface depolymerizes and turns into, essentially, ordinary glass. I can autoclave the heck out if it, blast it with UV, and indulge in all manner of molecular paranoia.

If I can figure out a way to reliably sterilize thermoplastic, I'll skip the business with the PDMS casting, and simply print microtiter plates directly, like this :

By the way, I used the dimensions of a Corning round-bottom 96 well microplate. You can download the model from my account on Thingiverse.

So, I ordered a personal 3D printer. It looks like the hottest Open Source personal 3D printer right now, and the only one with a build volume larger than a titer plate, is the Ultimaker. I'd have really liked to have gone with MakerBot Industries' Thing-o-Matic, but the build volume is just a scoche too small. Come on, guys! Just a few more millimeters? Please?

Unfortunately, the Ultimaker has a four to six week lead time, so I have to wait for a while before ours arrives. At the suggestion of Ian Holmes, I headed off to Noisebridge, a hackerspace in the San Francisco's Mission District where they have a couple of 3D printers available for people to use. The machines are Cupcake CNC's, MakerBot's first kit. The ones at Noisebridge are... well, let's just say they are well-loved. The one I used had to be re-calibrated before it would go. 3D printers are pretty straightforward machines when it comes down to it, so it only took me a couple of minutes of poking around at it to figure out how to make the right adjustments. Then, it worked like a charm!

As you can see, I was a bit conservative about the design, since I wasn't sure how good the print quality would be (especially after my cack-handed ministrations).

I'm experimenting with PDMS casting now, but I'm going try some tests to see how thoroughly I can clean thermoplastic with UV. I'd really like to just order up a nice 384 well plate, and get right to it!

Anyway, I need to thank (or perhaps blame) Aaron Darling for getting me interested in transposon-based library construction, and for pointing out their significance to me.

New Equipment Thursday

Posted by Russell on August 25, 2011 at 7:40 p.m.
My vacuum desiccator arrived today, and so naturally I put it to productive use. You know. For science.

Haw! This thing is cool.

Sneak Pique

Posted by Russell on July 13, 2011 at 3:41 a.m.
I'm about to release a new piece of Open Source software; it's a fast, fully automated and very accurate analysis package for doing ChIP-seq with bacteria and archaea. I'm doing my best to avoid the sundry annoyances of of bioinformatics software; it uses standard, widely used file formats, it generates error messages that might actually help the user figure out what's wrong, and I've designed the internals to be easily hackable.

I have two problems, though.

Most of the people who will be interested in using this software are microbiologists and systems biologists, not computer people. At the moment, the software is a python package that depends on scipy, numpy and pysam. I used setuptools, wrote tests with nose, and hosted it on github. If I were going to distribute it to experienced Linux users, it's basically done. However, installing these dependencies on Windows and MacOS is a showstopper for most people -- scipy in particular. So, how would you suggest distributing it to MacOS and Windows users?

The second problem is... it's kind of ugly. I wrote the GUI in Tk, which is not particularly great in the looks department. Should I bother creating native tooklkit GUIs? Would that make people significantly more comfortable? Or would it be a waste of time?

PLoS TWO : A new open access journal

Posted by Russell on June 14, 2011 at 9 p.m.
People surely suffer worse injustices than the denial of instantaneous access to the latest scientific research. Nevertheless, this particular habit lacks a feature common to most unjust practices; that one party benefits at another's expense. The restriction of access to basic research hurts absolutely everyone. It's throwing sand in the gears of the engine of progress. We can debate about whether it is more apt to call it a spoonful or a truckload, but the damage is clear.

One might suppose that publishers benefit from the system of closed-access journals, but this cynical view exaggerates the importance of the relatively paltry sums of cash involved and disparages the value of scientific and technological progress. Publisher's cannot cure their cancers by wallowing in hoarded journal papers, but posting the hoard on the internet stands a fighting chance.

So, I'm exceedingly glad that Nature Publishing Group has elected to step into the ring in the corner of this fighting chance by launching Scientific Reports. Many have noted that in many important respects, Scientific Reports is a clone of PLoS ONE.

It has not escaped our notice that as recently as 2008, Nature's Declan Butler was sneering at PLoS for the practice of "bulk, cheap publishing of lower quality papers." I'm sure the powers that be at Nature were expecting quite a few wry smiles at news of the launch.

Nevertheless, it's one thing to do the right thing when you're filled with righteous light. It's another thing altogether when it makes you look a bit silly. I'm as guilty as anyone for poking fun at Nature; as soon as I heard the news back in January, I gleefully registered PLoSTWO.org, and have spent the last couple of months plotting elaborate satire.

Now that they've launched, I must admit that the inaugural papers look pretty interesting. You'd better get your jokes in while they're still funny. This is not a case of Nature verses PLoS. In this fight, it's Nature and PLoS in one corner of the ring, and ignorance on the other. It is good news for everyone that Nature has learned from its comrade-in-arms how to throw a better uppercut.

Update July 1, 2001 : While they evidently appreciated the humor, PLoS regretfully asked me to take down PLoSTWO.org. Instead of just letting it go dark, I'm going to (voluntarily!) transfer it over to them once they think of something to do with it. For now, it'll point at the PLoS ONE About page.

Wine states, Beer states

Posted by Russell on May 26, 2011 at 1 a.m.
I was playing around with Google Lab's latest nifty gizmo, Google Correlate, and came across this interesting little tuft of statistical ephemera. Here is the distribution of searches for "wine" verses "beer" across US states.

I suppose that's... basically what I expected. I thought this would be a nice little homage to the 35th anniversary of the Judgement of Paris, the event which catapulted California wines out of unpopular obscurity and onto the world scene (and is also a beautifully wry literary allusion).

Questions of microbial ecology

Posted by Russell on April 27, 2011 at 10:50 p.m.
When the first environmental sequencing projects were conducted, the genetic bredth present within an environmental sample so far outstripped the available sequencing capacity at the time that it was only possible to obtain a tiny slice of the genetic material present. This gave researchers two choices; either target a particular gene, or go fishing. Both approaches have been extremely fruitful. Targeted studies of ribosomal RNA led to the discovery of the archaea, among other important accomplishments. The "fishing" approach (which has a shorter history) has also led to exciting discoveries. If you do a literature search for your favorite enzyme with the word "novel," it's quite likely that most of the recent publications will involve some kind of metagenomic survey.

As the cost of sequencing continues to plummet, a third approach to environmental sequencing has suddenly become possible: Exhaustive sequencing. It should be possible not only to survey the entire genomes of the organisms present (although assembling them is another story), but also to survey the population-level variability of the organisms present. This is a rather unprecedented development. Microbial communities have suddenly gone from the most challenging ecologies, with only a handful of observable characters, to a spectacularly detailed quantitative picture.

Here is an example from one of my datasets :

This is a small region in the genome of Roseiflexus castenholzii. I have mapped reads from an environmental sample to the reference genome, yielding an average coverage of about 190x. If you look closely at the column in the middle (position 12519 in the genome, in case you care), we see some clear evidence of a single nucleotide polymorphism in this population of this organism.

As it happens, this coordinate falls in what appears to be an intergenic region, between a phospholipid/glycerol acyltransferase gene on the forward strand to the left and a glycosyl transferase gene one the reverse strand to the right. The two versions appear with roughly equal frequency in the data. For this organism, I've found single nucleotide polymorphisms at thousands of sites. There are also insertions and deletions, and probably rearrangements.

In this ecosystem, I'm able to get between 50x and 300x coverage for almost every taxon present. This should make it possible to see variants that make up only a percent or two of their respective taxon's population. With data like this, it should be possible to do some really beautiful ecology!

For example, suppose one wanted to see if a community obeys the island biogeography model. One could measure the theory's three parameters, immigration, emigration and extinction, by comparing the arrivals and disappearances of variants between the "mainland" and the "island" over time. The ability to examine variants within taxa should make these measurements very sensitive. Additionally, because these are genomic characters, it should be possible to control for the effects of selection (to some extent) by leveraging our knowledge of their genomic context. The 12519th nucleotide of the R. castenholzii genome is perhaps a good example of a character that is unlikely to be under selection because it happens to sit downstream from both flanking genes.1

So, here is my question to you : What ecological model or process would you be most excited to see studied in this way?

1 Well, actually I haven't looked at this site in detail, so I'm not sure if one would or wouldn't reasonably expect it to be under selection. My hunch is that it is less likely to be under stringent selection than most other sites. I'm basing this hunch on eyeballing the distance of this locus from where I think RNA polymerase would be ejected on either side, and that both transcripts terminate into its neighborhood. My point is that it should be possible to have some idea of how selection might operate on a particular locus based on its genomic context. One should take this with the usual grain of salt that accompanies inferences drawn solely from models. A better example would be a polymorphism among synonymous codons, but I wasn't able to find one in a hurry.

Bioengineering side project

Posted by Russell on February 22, 2011 at 5:10 p.m.
I've been working on a little bioengineering side project, and I just finished putting together a working version of the firmware. It'll probably take some refinement, but I've managed to get the microcontroller to do what I need it to do -- measure visible light irradiance over a wide range of intensities.

This is the light intensity in microwatts per square centimeter measured at about a 0.3 second resolution. I haven't done any of the actual bio- part of the bioengineering, so for the moment the light curve is the beginnings of a sunset at Mishka's cafe.

I'll post more about this once I have the prototype working. Next up, 3D printing!

A sequencer of our own

Posted by Russell on January 27, 2011 at 4:12 p.m.
We just finished running our new GS Jr. gene sequencer for the first time. It produced 115,698 shotgun reads of our E. coli. Here is the read length histogram :

And the GC content histogram :

This was our first time going through the shotgun library protocol, which is pretty involved. For example, we're going to have to be more careful next time when we load the picotiter plate. We got a few bubbles trapped in there. It's kind of funny how obvious the bubbles are in the raw florescence images (this is an A, around cycle 200) :

I've uploaded the FASTA file and the qual file, in case you want to try to assemble your own E. coli genome.

Needed : Django hacker

Posted by Russell on December 23, 2010 at 6:41 p.m.
So, back in 2008, I ported Vort.org fro Rails to Django. It was about one evening of hacking, and since then I haven't touched the code, nor have I upgraded to Django 1.0. All I've done is patch security holes. Since then, a whole new comment framework was introduced, the one I'm using has been obsoleted, and a whole bunch of other changes have happened.

I've been much too busy to maintain or upgrade the code, and it wasn't very good to begin with. So, I'd like to hire someone who actually has some professional experience with Django to institute a do-over. I can handle importing all my articles and comments myself, even if the DB model is a little different. If you can do some nice graphic design, I'll happily pay extra for that.

As it happens, our lab is looking to hire a full-time web developer for a very awesome new project. If I'm impressed with the way you handle this simple little project, you can consider it a job interview for the full time position in our lab. And honestly, how often do you get paid for a job interview?

Email me your resume and a portfolio if you are interested.

Engadget thinks everything is an iPod dock

Posted by Russell on December 23, 2010 at 5:43 p.m.
Oh Engadget, how trite art thou? Leave it to them to get excited about the iPod dock on a machine that will be the least expensive and fastest DNA sequencer yet built. The iPod dock is one of several options the Ion Torrent machine has for attaching external mass storage. Why is it there? Because if you're going to pay fifty grand for a sequencer, it's just good business to spring for the two dollars worth of parts if it lets potential customers use whatever mass storage options they have available.

Harf. Leave it to Engadget to write an article that is actually less interesting than the press release.

Let the tax cuts expire

Posted by Russell on December 13, 2010 at 2:57 a.m.
In 2009, my adjusted gross income was $20,333, and I paid $793 in federal income taxes, and $147 in California income taxes, for a total of $940. Thus, my total effective income tax rate for the year was 4.6%. I don't mind disclosing this information because the official policy of the Microbiology Graduate Group is that all graduate students are paid $26,000 a year. Anyone could have worked out my income and tax rate to within a few percent from that fact alone.

So, 4.6%. Now, I don't particularly like the idea of paying higher taxes, but if I saw my taxes go from 4.6% to 6%, for example, it would have no noticeable impact whatsoever on my standard of living. I think I spend more than 1.6% of my income on coffee anyway.

Similarly, if my taxes were cut to zero, that would also have no noticeable impact on my standard of living -- ignoring, for a moment, the impact this would have on state and federal services.

Of course, things would look a little different if I earned more, which is the genius of marginal tax rates. Most of the time, people think about taxes in terms of their total "tax burden," but that is a very childish way to look at it. The first big chunk of your income is essentially tax-free, and is supposed to be big enough to meet your basic needs. The reason I only pay 4.6% is because I don't earn much more than what I need to cover my basic needs -- as you would expect for a graduate student salary. If it were too comfortable, people would never graduate, but if it was significantly lower, recruiting students would be impossible.

After that first chunk of income (about $10,000 in my case), there is another chunk of money that is taxed at the lowest rate, and then another chunk at a higher rate, and so on. Here's what it looks like :

Green : Russell's adjusted income
Red : Adjusted median income for women with a bachelor's degree
Blue : Adjusted median income for men with a bachelor's degree

It's sad, but the median personal income for men with a bachelor's degree is about $20,000 more than women. My own income is about $20,000 less than the median income for women with a bachelor's degree. It would be nice if both of those problems were solved...

As you can see, the medians are about an order of magnitude below the top bracket, and my own income is almost two orders of magnitude away. The Bush tax cuts are overwhelmingly aimed at the top three brackets. What most people are probably not aware of is just how few Americans are in those tax brackets.

What would happen if the tax cuts expire? Well, for me, and for most Americans, not very much. My taxes would go up about by about half a percent, which at my income isn't even enough for a cup of coffee a day. As far as my own interests, I don't care.

At the median income, most people would be looking at a tax increase of between zero and three percent, depending on deductions. The biggest worry is that this might "push people over the edge" into defaulting on their mortgages. This is very unlikely -- if your mortgage is large relative to your income, then so is your deduction for the mortgage interest. The people who are "near the edge" will be affected the least, if at all.

The second concern is that raising people's taxes will "hurt the economy," presumably because people will spend less. The small-ish increase in marginal tax rates for the overwhelming majority of Americans is much more likely to impact saving rates than spending rates. Most households have already cut their spending as much as they're willing to, which is part of the reason the economy continues to suck.

At this particular moment in history, the most likely result of raising taxes would be to increase investment. Why? Because investment is all about the balance between fear and greed, and right now fear is running the show. For investors and businesses, slightly higher taxes would mean slightly lower profits today, but would mean brighter prospects for the future than are anticipated under current circumstances. With the Bush tax cuts in place, our government is in very bad fiscal shape. Leaving them in place for much longer would do permanent, long-term damage to our prospects as a leading economy. Stabilizing the federal budget -- even if it means lower profits today -- would have a salutatory effect on business and investment.

Many people firmly believe spending is the problem, and that we should balance the budget by cutting it. This is mathematically true and economically false without major, mostly negative changes to social and foreign policy. Being a world power costs money, and there's no way around that fact. Investors understand this perfectly, even if the pundits don't.

What about people above the median? Personally, as a matter of policy I don't think it makes sense to worry about them very much. People earning $100,000 or more will be absolutely fine, regardless of any tinkering with marginal tax rates. We could set the top three brackets to 100%, and nobody in America would experience anything that could be mistaken for actual hardship. That isn't to say that those fortunate few would be happy, but nobody is going to starve on $171,850 a year. Raising the top three income brackets by less than five percent will have a negligible impact on the lives of those who enjoy the good fortune to earn enough to be affected. It will have a huge, entirely positive effect on financial stability of the United States of America.

What angers me, and a lot of people who care about the future of this country, is what these tax cuts have done to the federal budget. When Bill Clinton left office, the government was running a surplus. The TV pundits and op-ed colonists have insisted on saying, over and over, that Congress has been "spending like drunken sailors." (An expression that I find rather insulting, to tell the truth. I know a few people in the US Navy, and they spend most of their time worrying about making payments on their used cars.) In fact, we would be looking at a return to surpluses once the economy recovers, were it not for two factors :

  • The wars in Iraq and Afghanistan
  • The Bush tax cuts
When the economy recovers, the public will get most of the "bailout" money back. In some cases, like the General Motors receivership, the public may even receive a profit.

Wars and tax cuts got us into this mess. Pure and simple.

The necessity of the war spending is debatable, but the necessity of the tax cuts is not. They are a useless giveaway to people who already have enough.

Nobody is going to be totally happy with every aspect of federal spending, but don't you dare call yourself a fiscal conservative unless you are willing to do you part to insure that the government can cover its expenses. It's your goddamned government, like it or not.

Fun with de Bruijn graphs

Posted by Russell on October 29, 2010 at 4:34 a.m.
One of the projects I'm working on right now involves searching a better approaches to assembling short read data metagenomic data. Many of the popular short read assembly algorithms rely on a mathematical object called a de Bruijn graph. I wanted to play around with these things without having to rummage around in the guts of a real assembler. Real assemblers have to be designed with speed and memory conservation in mind -- or, at least they ought to be. So, I decided to write my own. My implementation is written in pure Python, so it's probably not going to win any points for speed (I may add some optimization later). However, it is pretty useful if all you want to tinker around with de Bruijn graphs.

Anyway, here is the de Bruijn graph for the sequence gggctagcgtttaagttcga projected into 4-mer space :

This is the de Bruijn graph in 32-mer space for a longer sequence (it happens to be a 16S rRNA sequence for a newly discovered, soon-to-be-announced species of Archaea).

It looks like a big scribble because it's folded up to fit into the viewing box. Topologically, it's actually just two long strands; one for the forward sequence, and one for its reverse compliment. There are only four termini, and if you follow them around the scribble, you won't find any branching.

raygun : a simple NCBI BLAST wrapper for Python

Posted by Russell on October 25, 2010 at 11:42 a.m.
Things have been a little quiet on Vort.org for the last couple of weeks, but a lot of frantic activity has been going on behind the peaceful lack blog updates. When I returned from Kamchatka, Jonathan had a little present for me -- he took the DNA from the 2005 Uzon field season for Arkashin and Zavarzin hotsprings, and ran a whole lane of paired-end sequencing on one of our Illumina machines. Charlie made some really beautiful libraries, and the data is really, really excellent. For the last couple of weeks, I've been trying to do justice to it.

I'm not quite ready to talk about what I've been finding, but I thought I would take a moment to share a little tool I wrote along the way. It's made my life a lot easier, and maybe other people could get some use out of it.

It's called raygun, a very simple Python interface for running local NCBI BLAST queries. You initialize a RayGun object with a FASTA file containing your target sequences, and then you can query it with strings or other FASTA files. It parses the BLAST output into a list of dictionary objects, so that you can get right to work.

It doesn't take a lot of scripting chops to do this without an interface, of course, and there are other Python tools for running BLAST queries. The advantage of raygun over either the DIY approach or the BioPython approach is that raygun is extremely simple to use. I wanted something that would basically be point-and-shoot :

import raygun
import cleverness

rg = raygun.RayGun( 'ZOMG_DNA_OMG_OMG.fa' )

hits = rg.blastfile( 'very_clever_query.fa' )

results = []
for hit in hits :
    results.append( cleverness.good_idea( hit[ 'subject' ] ) )

cleverness.output_phd_thesis( results )
Unfortunately, you must furnish your own implementation of the cleverness module.

I designed raygun is with interactive use in mind, particularly with ipython (by the way, if you do a lot of work in python and you're not using ipython, you're being silly). The code is available on github.

My talk at the Thermophiles Workshop

Posted by Russell on August 25, 2010 at 2:34 p.m.
When I registered for the workshop, the organizers asked me to give a 20 minute talk on my topic of research. I only just finished my coursework in May, so I didn't have a great deal of work to present (at least not in microbiology...).

So, I submitted an abstract titled, "Classification of environmental sequence data using multiple sources of inference." This project is a collaboration with Andrey Kislyuk, who has just graduated from Georgia Tech, supervised by Joshua Weitz. It's a pretty cool project, but Andrey has just graduated and moved on to Pacific Biosciences, so things haven't moved as quickly as I would have liked.

After the first day of talks, I started to get pretty nervous; I thought I would have some downtime during the field expedition to work on my slides. Downtime when Frank Robb, Albert Colman and Anna Perevalova are around? Ha! If I'd met them before walking off the airplane in Petropavlovsk, I would have known how ridiculous an idea that was.

To make matters worse, the organizers had to shift the schedule forward by a day because weather delayed the excursion to Uzon (which I was not planning to join, since I'd just spent a week there). Thus, I found myself in the position of giving and unfinished talk about an unfinished project. Worse, I was going to stand up and talk about probability theory and Bayesian priors to a roomfull of people who ride submarines into underwater volcanoes and discover whole new branches of Earthly life. Worse still, I had to follow Frank Robb's talk about isolating and sequencing organisms that grow on syngas, which he had to cut short because there was just too much awesome for one talk to hold.

To my surprise, I manged to finish the slides during lunch and the coffee break. Also to my surprise, I got a lot of really great questions, and lots of people seemed weirdly excited about the idea of using more than one mathematical technique for sifting through metagenomic data.

I've recently started working on one such analysis (a different project altogether), and I'm gaining an appreciation for just how difficult it is. Perhaps the interest in my talk has more to do with the fact that people in the field really, really want better tools, and there's a lot of enthusiasm for anything that looks halfway promising.

Also, I have to give a big thumbs up to the Russians (and other folks) who gave their talks in English. I once had to give a brief talk on physics in Japanese, and it was one of the most difficult, stressful experiences of my life. It was only five minutes, and I was aided by the fact that Japanese borrows many technical and scientific terms from English. It's not really fair that English is the de facto international language, but I'm really, really glad it is.

Thermophiles workshop overview

Posted by Russell on August 23, 2010 at 12:27 p.m.
After landing at the airport, we crammed our equipment and ourselves into a taxi-van, and returned to the little apartment we stayed in before leaving for Uzon. There's a washing machine there, so we ran as many loads of laundry as possible.


Back at the apartment in Petropavlovsk, we tried (and mostly failed) to get the smell of hydrogen sulphide off of us.

Then next day, we piled into another taxi-van and rode to the Flamingo Hotel, where the workshop will start tomorrow.

Update : Below is a summary of my favorite talks at the workshop that I wrote on the flight back to California.

There have been a number of really exciting talks here at the workshop, and I can't summarize all of them. So, here are a few talks that have kept me thinking.

Sergey Varfolomeev : The youngest natural oil on Earth

Carbon-14 dating indicates that Uzon contains petroleum-like oil that is less than 50 years old. Very similar compounds were obtained by low-temperature pyrolysis of cyanobacteria and microalgae isolated in the vicinity to the hydrocarbon sample sites.

Albert Colman : Chemistry and geobiology of life in hot carbon monoxide

One of the key events in the establishment of our existing ecology was the development of an oxygen rich atmosphere. This process occurred in several stages, and one of the key stages marked the end of the Archean eon. Archean ecosystems are thought to have included oxygen-producing organisms, but during the Archean eon there were enough free reducing compounds in the atmosphere, ocean and soil to consume all the oxygen they produced. The Archean eon ended when these chemical oxygen sinks were finally overwhelmed, and oxygen started to build up in the atmosphere. In order to understand how and why we have an oxygen-rich atmosphere, it is important to understand how the Earth's atmosphere worked during this period.

Albert and his group are studying the role of carbon monoxide in the Archean atmosphere. There are a variety of organisms that exist today (particularly in volcanic environments like Uzon) that grow on carbon monoxide, and for this reason, the biosphere is usually treated as a sink for carbon monoxide. However, there are also organisms that produce carbon monoxide as a waste product, and so the coupling of atmospheric carbon monoxide to the biosphere in Archean climate models needs to treat the biosphere as a source and a sink to properly capture the dynamics.

I find all of this to be fascinating. It's very important that we get a handle on this stuff; mankind has been conducing a huge, uncontrolled experiment with the Earth's atmosphere since around 1820. Learning about other such "experiments" in Earth's history (in Archean, by microbes rather than humans) is pretty important.

Evengy Nikolaev : Mass spectrometry

I had no idea there were so many kinds of mass spectrometers! I guess that's what I get for my background in theoretical physics. My inclination is to write

and call it a day. Mass spectrometry, to me at least, has always meant this :


Schematic of a basic mass spectrometer.

If you stick some ions in a constant magnetic field, their orbital frequencies will depend only on their mass and charge. So, you just aim your beam of ions through a magnet, and all your ions will segregate out like colors in a rainbow. Done. High school physics, right? Wrong!

Evengy's talk was like looking up a recipe for pancakes and discovering that there are breakfast, lunch, tea, and dinner pancakes; that they can be made from fifty different grains and pulses; and that there are pancake recipes suitable for every occasion ranging from a quick bite while driving to work in the morning to the main course of a king's coronation. That's a lot of mass spectrometry!

Juergen Wiegel : Interspecies heterogeneity and biogeography of Thermoanaerobacter uzonensis

I'm really interested in biogeography generally, and so I was waiting for this talk. The Baas-Becking hypothesis that "everything is everywhere, but the environment selects" has been one of the key ideas in microbiology. As gene sequencing has gotten more powerful, it has been possible to test this hypothesis with increasing confidence. Juergen presented some findings that take another step toward disproving hypothesis and establishing the importance of locality in evolution.

Basically, his group at the University of Georgia obtained 16s small subunit rRNA sequences from Thermoanaerobacter uzonensis isolates collected in different spots in Kamchatka. The collection sites ranged from a few meters apart to about 300 kilometers. It was found that divergence among the sequences correlated positively with geographic distance.

The environment does indeed select, but the Baas-Becking hypothesis only holds for fuzzy definitions of "everything" and "everywhere."

Anna Perevalova : Novel thermophilic archaea of order Fervidicoccales - diversity, distribution and metabolism

I had been bugging Anna during the field expedition to tell me more about Fervidococcus fontis, which she discovered. F. fontis grows between 55C and 85C, which is an unusually wide range. The genome has recently been sequenced, and she presented some of the preliminary results from the annotation.

I still find it mysterious how one sets out to find new species (in this case, a new genus). Anna works in Elizaveta Bonch-Osmolovskaya's lab at the Winogradsky Institute of Microbiology, where they used a technique I'd never heard of called Denaturing Gradient Gel Electrophoresis and a myriad of selective media cultures to coax this organism out of the woodwork. Pretty hard-core, if you ask me.

Sergey Gavrilov : Electrochemical potential and microbial community composition of bioelectrochemical systems employed in situ in hotsprings of Uzon Caldera

This is a pretty awesome idea. Microbial fuel cells exploit the fact that cellular metabolism requires the transport of electrons outside the cell to deposit on acceptor substances, and couple this process to an electrical circuit. Sergey discussed a modification of this idea called sediment microbial fuel cell; instead of growing his microbes in the lab, he carried his cathode and anode out into the field and stuck them into a sedimentary formation in the environment.

The awesome part of this study is that Sergey isn't just looking for high power output. He's using the fuel cell to select for current-producing organisms from a diverse community, and then studying those organisms. After letting his circuits run for ten days, he found biofilms growing on the electrodes that had very different community structure from the controls (same setup, but with an open circuit). It's basically an enrichment culture that enriches for microbes that like to make electricity.

David Bernick : New discoveries in the hyperthermophilic genus Pyrobaculum enabled by deep RNA and genome sequencing

It's interesting to see how much fine structure can be found when an organism is sequenced deeply enough to capture it. David's team is using massive Illumina sequencing to do something like the Hubble Deep Field for an archaeal genome and its small RNA. They also sequenced a new member of the genus, P. oguniense, and discovered therein a new virus and a number of cool virus-related genomic features in the host.

Frank Robb : Lessons learned from sequencing carboxydotrophic bacteria and the race to discover hyperthermophilic cellulases

Frank was the only person at the workshop to give two talks, and they were both pretty cool. The first talk summarized results presented in a paper amusingly titled ‘That which does not kill us only makes us stronger’: the role of carbon monoxide in thermophilic microbial consortia. This work covered a lot of ground, including some compelling evidence for archaea-to-bacteria lateral gene transfer of chaparonins, as well as a results showing rapid accumulation of frameshift mutations when C. hydrogenoformans is grown under syngas, allowing it to grow rapidly by fixing carbon monoxide from syngas. Syngas is also known as wood gas, a simple intermediate for converting a variety of biomass feedstocks into usable fuel. If one wanted to obtain pure hydrogen gas from syngas, an organism that can eat the carbon monoxide could be handy.

The second talk presented some really interesting work in which a consortium of one cultured and two novel archaea was isolated from a thermal spring in Nevada that was able to grow on filter paper at 90C. A cellulase capable of degrading crystalline cellulose into reducing sugars at 100C was isolated, and the genes responsible were cloned and expressed in E. coli.

This is also pretty exciting for the biofuels people. One of the problems with moderate-temperature cellulases is that it's impossible to keep a huge vat of wet, ground up plants sterile. As soon as cellulase activity starts putting simple sugars into solution, something will start to eat the sugars. However, if you conduct the process at pasteurization temperatures, then you just have to worry about contamination by hyperthermophiles. So, as long as you keep people like Frank Robb and Karl Stetter from dropping their used lab equipment into your processing vat, you should get a nice yield of sugars from the cellulose without having it all eaten up by pesky yeasts and suchlike.

Uzon, Day Seven

Posted by Russell on August 22, 2010 at 8 a.m.
This post is for August 11th, 2010

Sarah and Albert managed to finish the DNA extractions last night, much to everyone's relief. Early that morning, we were visited by another bear, which we caught on video this time.

As we started packing up our gear, we got word that the helicopter would be arriving to pick us up around mid-morning, rather than mid afternoon as we had expected. A furious scramble to pack everything up began, and Frank set off into the field alone to retrieve enrichment cultures that we hadn't collected yesterday.

I tried my best to stay out of the way, since I had already mostly packed up the day before (no great accomplishment -- I didn't bring much in the first place). All of my samples were already safely stowed with Albert's. In retrospect, I should have gone with Frank to help him, but he vanished almost the instant we heard the thwak-thwak of the helicopter coming over the caldera wall.


Bo He carrying equipment to the helicopter flight from Uzon.

Just as we finished packing the helicopter, Frank came charging over the ridge from Central Thermal Field carrying all the enrichment samples he could find.


Packing the helicopter.

Amazingly, we only left a few things behind. A small digital camera, my toothbrush, and a few enrichment samples that sank too deep into one of the springs. Later on, Albert was able to retrieve the samples and the camera by joining the workshop excursion. He did not retrieve my toothbrush.


Karymsky volcano erupted again on our flight back. A most majestic farewell.

On our flight back, Karymsky volcano erupted again, again just as we flew past. It was a majestic farewell indeed.

I really, really regretted having to leave Uzon. It was a privilege and an honor to have gone, and to have gone with such company. In the next weeks and months I will have to work very hard; perhaps a big enough scientific payoff might justify a return trip. I certainly hope so!

Uzon, Day Six

Posted by Russell on August 20, 2010 at 4:44 p.m.
This post is for August 11th, 2010

Russia is working hard to reign in the chaos that followed the end of the Soviet Union, and Kronotsky National Biosphere Park is no exception. Restrictions on hunting and fishing that were once widely ignored or impossible to implement are now being enforced. The rules are not exactly settled, but it is clear that the park administration is serious about protecting the wild state of the preserve. This is a Very Good Thing.

In 2005, Frank joined an expedition to Uzon led by Juergen Wiegel; this was before the research station was built, and so they flew in several large tents packed in crates. The crates could be unfolded to form a platform for the tents. When they broke camp, they left the crates behind. If the park administration is going to be serious about protecting the natural state of the caldera, Frank and Albert thought it would be a good idea to do our part too. So, we spent the morning breaking down the crates at the 2004 camp. We then hauled the disassembled crates to the research station (new since 2004), and arranged them in neat stacks. The rangers will find some use for the wood now that in easy reach, I'm sure.

When we arrived, the crates from the old camp were piled up in the middle of the camp. I'm not sure exactly how long the crates were splayed over the ground at the old site (they were designed to form a platform for the tents) before they were piled up there, but I find it interesting that the footprint of the old camp is still clearly visible. The plants are still in the process of recolonizing the space. There can be no more explicit evidence that Uzon's ecology is indeed fragile. The lush meadows I wrote about yesterday would probably take decades or centuries to form if they had to start over from scratch. I'm sorry I don't have any pictures; one cannot be both a good photographer and diligent manual labor at the same time.


Alex thinks he has pulled a fast one on me. Anna is not amused by any of this. Not even Frank's hat.

After lunch, Frank and I set out together to collect some samples from Burlyaschy and K4 Well.


Collecting a sample from Burlyaschy (Boiling Spring). It's about 90C where my feet are, and it's deeper than my ankles. It's a good thing I'm wearing thigh waders and three pairs of socks!

While Frank was working on his own samples, I waded a few meters into Burlyaschy Spring to fill a liter bottle with water. The water is about 90C there, and boiling vigorously only three or four meters beyond. I was wearing three layers of insulated gloves, and three pairs of socks under my waders, but the heat was almost unbearable. You really don't want to fall down in this thing!


Filtering a liter of water from Burlyaschy with a Sterivex filter and a 60ml syringe. The bottle was almost too hot to handle, even with insulated gloves. If there's anything alive in the planktonic community, it's definitely a hyperthermophile!

After (carefully) returning to what passes for dry land in the thermal field, I decanted the liter bottle into a 60ml syringe with a LuerLok fitting, and attached a Sterivex-HV 0.45 micron filter. I then forced the water through the filter, which started to block up after about 600ml. The last 300ml went through really, really slowly and with a lot of sweat and cursing. It took a 20 repetitions to finish off the bottle.


Decanting spring water collected from K4 Well into a 60ml syringe, to be forced through a Sterivex filter.

After that, we walked over to K4 Well to collect Frank's slides. Frank is planning to use them for electron microscopy, so he had to fix them before storing them, which took a long time. This gave me time to process two liters of water and steam spewing from the rupture on the K4 wellhead and shove them through two more Sterivex filters.

We walked back to the station, and I fixed my filters in ethanol and D-PBS buffer.

This was to be our last full day in Uzon, so I packed most of my things before going to bed. Albert and Sarah stayed up all night finishing the DNA extractions.

Uzon, Day Five

Posted by Russell on August 20, 2010 at 3:36 p.m.
This post is for August 10th, 2010

The weather is absolutely beautiful today; sunny with a few puffy, fast-moving clouds, about 60F with gusts of cool wind.

After breakfast, Frank, Alex, Anna and I hiked to Orange Field. Most of the hike was over open country without trails; we had the GPS coordinates, but no route. We passed through a few stands of birch and pine. The prospect of encountering a bear in enclosed areas makes entering these clumps of trees an unattractive course of action, one could say. Encountering the occasional bear seems to be unavoidable in Uzon, so we stuck to open country and burned up some calories circling around the trees. The August sun could have made this torture back in Davis, but at almost 55 degrees north with patches of snow lurking in the shady spots of the caldera, it wasn't so bad.


A meadow abutting the caldera wall on the hike to Orange Field springs.

It's astonishing how much plant diversity there is here. What looks like fields from a distance are really dense mixtures of dozens (hundreds?) of species of plant, crowded together in a tangled riot. When I put my face near the ground, it looks a tropical rain forest, only ten inches high.

We are here to study microbes, but it's very difficult not to wonder about this hardy community of plants. How do they survive the winter? Why does one kind of plant cluster in one place and not another? For what do they compete, and how do they do it? Do any of them cooperate? How do the seeds disperse? What pollinates the flowers?

I am puzzled I that there seem to be so few pollinators in Uzon. I found a few insects that looked like bees, but I'm not familiar enough with entomology to rule out the possibility that they could be bee-like flies, or possibly wasps. In any event, there were not very many of them. The only insect I found visiting a flower today is a thing that looked like an earwig, but it was probably there because it took a wrong turn somewhere. The millions of flowers in Uzon seem to go mostly unvisited.


Panorama from the ridge overlooking Orange Field springs.

Anya was here in Uzon in 2005, except a few weeks later in the year. In her pictures from that expedition, the whole caldera looks like it's been set afire as the hardwood brush gets ready to drop its leaves.

The other thing that puzzles me was how few birds there are. The caldera is bursting with blueberries and mosquitoes, and yet I've seen only one swallow and heard not a single songbird. Meadows in California with a tenth the productivity (i.e., insects, fruit and seeds) are usually crammed with swallows, starlings (introduced, of course), jays, finches and songbirds. In Uzon, there are only a few white, long-winged birds with V-shaped tails that fly low and fast above the streams. They look a bit like a quarter-scale seagull, but re-engineered for speed and extreme distance-flying. They have bodies built like marathon runners, so I suppose Uzon must be a quick stop on a long journey for them. I've only seen two or three of these on a given day so far.

The lack of birds, especially songbirds, and the lack of pollinators are probably related. The winter in Kamchatka is too harsh for most birds to overwinter, so most birds found here would be migratory. Insects are ideal diet for a long-distance migratory birds, and they need lots of them to build up enough fat reserves for their world-crossing journeys. Maybe our timing is off, and we've just missed the migratory birds, or maybe they will arrive later when the blueberries are riper, or when their favorite species of insect reaches its crescendo. Or, perhaps the birds that used to come here are gone, their migratory route destroyed by a parking lot in a faraway place.


A carnivorous plant waits for the arrival of small, unlucky insects on the bank of Orange Field springs.

Karnosky National Biosphere Preserve is for Russia what Yellowstone, Yosemite and the Grand Canyon are to America. It is perhaps the single most beloved natural site in this vast country, and the people who have studied and explored it are heroes in Russia (they should be heroes worldwide). Tatiana Ustinova, who discovered the Valley of the Geysers, could be the John Muir of Russia. I'm sure that someone has studied the songbirds in Uzon, or lack thereof, just as the songbirds of Yosemite have been meticulously studied. However, Ustinova only discovered the Valley of the Geysers in 1941, whereas Yosemite and Hetch Hetchy were well known to the world more than a hundred years prior.

The problem, I think, is the disconnect of the scientific literature among countries. Before I left for Kamchatka, I looked for books like John Muir Laws' beautifully illustrated field guide to the plants, fungi and animals of the Sierras, but I could not find anything. My questions have probably been asked and answered, but only in Russian, and probably only in journals far from the beaten path.

I hope that this will change.


Debris left over from Karpov's old house (I think), which was heated by geothermal power. I'm holding the auger used to drill the well.

At Orange Field, Alex and Anna collected several samples for their colleagues at the Russian Academy of Science. We spent about two hours roaming around and waiving Anna's GPS at the sky, trying to pinpoint which spring was which. This is an uncertain proposition in a place like Uzon, which is subject to the vicissitudes snow, snowmelt erosion, the dynamic processes of volcanism, and curious bears that like to dig holes.


Team Russia, for the win!

When we got back, we ran the generator for a while so Sarah could do her DNA extractions. I used the opportunity to work on metagenomic analysis for Arkashin and Zavarzin a bit, organize photos, assemble some panoramas, and edit the last couple of days of blog entries. I also got in some really excellent procrastination on finishing my talk. I squished one hundred and sixteen mosquitoes and three biting black flies.

Anna made Borscht for us again, and it was, if anything, even more delicious than her previous Borscht. Same ingredients, same pot, same stove, same sour cream. I am puzzled, but that seems to be my lot in life.

Uzon, Day Four

Posted by Russell on August 19, 2010 at 4:16 a.m.
This post is for August 9th, 2010

It was very cold, wet and windy this morning, and I had a rough time getting started. A double shot of espresso helped, but it took a brisk hike to Burlyaschy to collect my first samples of the expedition to actually wake up.


Collecting sediment samples from the outflow of Burlyaschy (Boiling Spring). This is my first field sample since starting grad school. Neat!

Frank and I thought it might be interesting to try to sample from the center of the spring near the heat source, so we tied a 50ml tube and a rock to a rope and dragged it across the bottom of the pool a few times. It didn't work, unfortunately, so we're going to try using a long tube and a hand pump tomorrow.


Our improvised sampling gadget. It didn't work unfortunately. The bottom of Burlyaschy evidently doesn't have any sediment.

Our efforts were interrupted by a bear, a real one this time, that wandered out from behind a hummock about fifty feet away. We dropped what we were doing and circled to the bank of Burlyaschy opposite the bear. In principle, we could sidle in one direction or the other to keep the spring between us and the bear. A bear can easily outrun a human in a straight line, but on a turn, particularly in boiling mud, we have a better chance. If it tried to cross the pool, we would quickly end up with a few thousand gallons of bear-and-microbe soup.


A bear interrupted our work at Burlyaschy.

Happily, the bear showed little interest in us, and wandered off. It doesn't make for great photography, but I've decided that the preferred view of a bear is the posterior as it walks away.


Fortunately, he showed very little interest in us.

We returned to the station without incident and had some lunch. Alex and Anna went off to collect some samples for their colleagues in Moscow, while Frank and Bo packed up his computer, a huge APC power supply, and his scanning voltometry apparatus lumbered off to Red White and Green. Right now, Sarah and I are upstairs with the Russian expedition to use the lab bench for DNA extractions.


Sarah working on DNA extractions.

Later on, the weather cleared up to reveal an extrodinary afternoon. I was persuaded to go to so-called Bath Pool with the Russians. I'm not sure if I am any cleaner as a result, but the experience was... interesting.


Anna and Alex returning from Central Thermal Field.

Uzon, Day Three

Posted by Russell on August 19, 2010 at 4:05 a.m.
This post is for August 8th, 2010.


Anna at Central Thermal Field. As the ranking Russian in our group, she is our chief scientist for this field expedition.

We awoke to heavy fog and rain this morning, and it was very cold. I went with Alex, Anna and Frank on a long hike to a group of petroleum-bearing springs. Along the way, we stopped at Boiling Spring (Burlyaschy in Russian), which really is boiling. We measured 96C near the edge, and it's about the size of a backyard swimming pool!


Boiling Spring.

Frank suggested on the walk back a few hours later that Boiling Spring might be an interesting metagenomic target; it's surrounded by extremely acidic formations -- we measured pH of 0.8 at one of them -- and yet Boiling Spring itself is at pH 7. It's likely to be relatively isolated from the surrounding environments. Because Uzon is much nearer to sea level than Yellowstone (650 meters, according to my phone), it's actually possible to find water at nearly 100C at the surface here. This suggests that it could be a good place to look for high temperature chemoautotrophs. Boiling Spring is also nearby an area known to be rich in petroleum sediments, so there could be high-temperature hydrocarbon utilizers too.


A petroileum-rich spring.

We then proceeded on to what Frank calls "the oil fields," where Alex, Frank and Anna took some more samples. There is a talk scheduled later at the Thermophiles Workshop by S.D. Varfolomeev called "The youngest oil on earth (Uzon, Kamchatka)," presenting evidence that there is petroleum at Uzon that is less than 50 years old!

Given the name "Oil Fields," I was expecting it to resemble La Brea Tar Pits in Los Angeles. I spent a lot of time at the Page Museum when I was young, so many of my formative experiences involved mammoths and smiladons and lakes of bubbling tar. I caught a few whiffs of that smell, but it was mostly the usual hotspring rotten-eggs.


We passed the ranger station on the way back, around three o'clock in the afternoon.

Around three o'clock, the rain finally let up enough for me to crawl out of my cheap yellow poncho. We ate a little bread and cheese we brought with us (and a chocolate bar, of course), and started hiking back toward the station. Along the way, we stopped to check on Frank's slides at K4 Well and then back to Red White and Green. Frank and Alex left some enrichment cultures to incubate at Red White and Green and another nearby spring with a very high temperature.

Alex and Anna wanted to keep working in the area, and so Frank and I hiked back to the station.

There was a tetrahedron of milk we opened for breakfast coffee, so I used it up to make an onion, garlic and dill fritatta for the two of us, and we talked some more about what might be living in the outflow from Boiling spring.

Alex and Anna eventually got back, and Anna made some scrambled eggs, and the ranger (Evgenij) joined us for lunch.

We spent the afternoon struggling to charge UPS for Bo's scanning voltometry gear. Balky generators and rain make a poor mix.

While that was going on, Bo, Albert and Sarah went to Burlyaschy (Boiling Spring). Albert spotted a mother bear with a cub nearby and moving toward them, so he readied one of our flare torches to scare them away. Before igniting the torch, Albert tried shouting a bit, and took a few steps toward the bears. The bears suddenly revealed themselves to be bushes in the fog, rattling in the wind.

Uzon, Day Two

Posted by Russell on August 16, 2010 at 3:41 p.m.
This post is for August 7th, 2010.

It was cold and cloudy today, which is actually a blessing. We have to walk around in thigh-high rubber boots and stand around boiling pots of sulfurous water, and the mosquitoes are murderous.

I think I've got the hang of making a decent espresso in the field, at least with this incredibly delicious water. I found an adapter in an outdoor store in Petropavlovsk that mates the valve socket for my camping stove to cheap cans of cooking gas available practically everywhere. Unfortunately, the cans are completely unstable with any sort of pot or pan sitting on the stove, so I braced the can with some bricks from an old cook fire.


Some espresso on a cold, wet morning.

I packed light, which means that tomorrow I'll be on my last pair of clean pants. Tomorrow I will have to do laundry.

This morning we visited Arkashin spring, which is the other sampling site for the metagenomic data I've been analyzing. It's loaded with realgar (arsenic sulphide), and so it's expected to be full of species that are resistant to the various forms of arsenic, arsenide, arsenate, and possibly arsenic respiring organisms. Alex and Sarah took some samples of the sediment.


Arkashin Spring, one of my metagenomic targets.

We also spent a lot of time looking at a nearby site called K4 well, which is the remains of an old exploratory well drilled sixteen meters into Central Thermal Field. As you can see, the steel has been pretty much destroyed by corrosive hydrogen sulphide gas. The interesting thing about K4 is that the outflow starts out as a mix of steam and boiling water at about 100C, and cools off to about 40C over a space of about three meters. As a result, the organisms that live in each temperature band between 100C and 40C are organized into stripes following the contours of the isotherms.


K4 Well, a possible site for investigating spacial organization of microbes.

Frank and Albert inserted some microscope slides into the flow (if you leave them there for a while, the microbial mat will incorporate the slide which you can then remove to study). I'm very interested in studying this sort of spacial organization, and so Frank gave me a slide to insert transecting three of these bands. Glass is a good conductor of heat, and so I'm not very confident that it will work.

On the way back to the station, we came across a very interesting pool that Albert thought would be a perfect for Bo to try out his electrochemical instruments. Bo didn't come with us for the morning trip because he was still polishing, plating and testing the electrodes for his setup. There obviously isn't any cell phone reception out here in Uzon, but my little Android phone still makes a really great field GPS. I marked the coordinates for the pool as "Red White and Green" (sadly, there was no blue).

For lunch, we had buckwheat with tomato sauce, green peas and tofu (the carnivores added their canned mystery meat). It tasted great, but the buckwheat didn't agree with me at all. I took some anti-acid tablets, and then passed out for an hour. I woke up a bit overwhelmed by the taste of buckwheat and hydrogen sulfide (for some reason, whenever I smell hydrogen sulphide, I seem to keep smelling and tasting it for a long time afterward). Bo still had to work on his electrodes for a while longer, and so I sat around with a cup of tea and waited for the afternoon trip.

Bo packed up his electrodes, data acquisition system, laptop and portable power supply into a huge backpack/duffel, and I guided everyone back to Red White and Green. The Android phone worked great as a field GPS.


Bo getting his first scanning voltammetry data.

This is some of Bo's data from the field. The peaks and dips represent changes in current detected passing from one electrode to the other (in the presence of a reference) as the voltage was swept from zero to -2V and back. The cathodes are made of gold wire plated with mercury film (sort of like old-fashioned dental fillings), and the anode is elemental platinum. Scanning voltammetry is also known as cyclic voltammetry; the trace on the bottom is the return signal when the voltage swept back to zero. In the order they appear in the scan, Bo's first guess as to the identity of each dissolved compound are as following; thiosulphate, hydrogen sulphide, iron sulphide, hydrogen peroxide, iron (or maybe manganese) (II)+, and on the return scan, acid volatile sulphide (AVS).

The software Bo uses to drive the probes is a little crusty, so I decided to help him out with a little Python/Matplotlib awesomeness.


One of Bo's voltammetry scans; the annotations are based on Bo and Albert's experience with the technique and their best judgment while in the field; this is not their "final" conclusion about the water chemistry. As the science goes, think of this as somewhere between raw ingredients and the finished product, like bowl of cake batter.

When we got back, I cooked dinner; pasta with corn, onions Lithuanian-style cheese and some Georgian spice mix. The carnivores added a mysterious can of meat with a picture of a cow on it.

I went outside this evening to send a twitter update with the Iridium phone, and I thought I was safe from the swarming mosquitoes in my bug suit and thick socks. When I say "swarm," I really mean it. As I stood on the boardwalk, it sounded exactly like a 2010 World Cup game, complete with vuvuzelas. I miscalculated badly, and I got twenty-nine bites on my feet -- through my hiking socks -- in the three minutes I was standing still. I didn't notice until my feet started burning, like the way your mouth burns when you eat a chili pepper. I ran inside and dunked my feet in a bucket of near-freezing stream water until the burning stopped. Then soap and more freezing water, topical astringent, and three antihistamine pills. I have a little bit of swelling, but hopefully not enough to stop me from getting out tomorrow.

To my delight, the entomologist staying here decided this was a great evening to take some samples of her own. She fired up the generator and put a huge flood light on the upstairs portico. Then she used sweep nets to capture bucketloads of mosquitoes, which she preserved in formaldehyde (or something of the sort). It warmed my heart to see that.

Before heading to bed, I figured out how to bathe with three liters of water. The pump is broken, and so if you want water, you have to lug it from the stream, and if you want hot water, you have to use the tea kettle.

Uzon, Day One

Posted by Russell on August 15, 2010 at 5:01 p.m.
The day began with a breakfast of rehydrated oatmeal, instant coffee (my espresso had not yet been located amongst the luggage), and yogurt. Just as we were drifting off to unpack and organize, a juvenile bear showed up on our doorstep, and snuffled around a bit near our outhouse and the little bridge over the stream.


A bear visiting the research station on our first day in Uzon. That boardwalk is the path to our outhouse; this was shot with a short lens from the kitchen porch.

This is why we carry signal flares to the toilet, and only go in groups.

After watching the bear wander off to forage for blueberries (which are everywhere), I sat down on the little bridge and made myself a cup of espresso from the stream water. The Russian team upstairs tells me that when they've tested it, it came back almost as clean as the molecular-grade water they brought with them. It was the best damn espresso I've ever had.


Espresso.

Preparations for sampling and measurements proceeded in fits and starts through the morning as Albert, Frank and Anna hammered out a plan for each day of the expedition. While that was going on, Bo, Sarah and I continued unpacking and organizing the gear.

I attempted to shave at the stream, but this did not go as well as the espresso. Hot water is important for shaving, and I didn't make enough of it. The stream is only seven degrees Celsius, which I discovered is utterly unsuitable for shaving.


Shaving did not go so well.

Around ten o'clock, the ranger took us on a tour of the thermal fields. Frank and Albert have been here several times of course, but the fields are never quite the same year-to-year. In 2008, for example, a geyser popped up near the ranger station; Uzon is not known to have geysers.


Zavarzin, one of my metagenomic targets. Alex is measuring the temperature, and we worked around some enrichment cultures set up by another research team.

We stopped by Zavarzin Spring along the way, which was particularly interesting for me. For the last few months, I've been analyzing some metagenomic data taken from Zavarzin a few years ago as part of the Tree of Life project. Until today, Zavarzin was just a FASTA file containing about ten thousand Sanger reads, like so :

>ZAVAK94TR 6000 12000 9000 21 953 GTAGCTGTAAGGGCGGGGAGGGCTCACCTGGTCCCGGCCTTCGACGGCGGCCCCAATCCG GCCAGCGCCCAGGCCCTCACCGAAGTCGAAGCCTACGCCTTTTCCTGTTCCGATTTCCGG AAACTGATAGGGGAGTTCCCCCGGATTGCCGGCAATATCCTGGCCGATTTTGCCGCCAAA TTGCGCCTGCTGGTAGGGCTGGTGGAGGACCTCTCCTTCCGTACGGTGGAGGCGCGTCTG GCCCGTTTCCTCCTGAGCCGGGATGTGGCCGTGCCCGGCCGGCGCTGGACCCAGGAGGAG ATGGCCGCCCACCTGGGCACGGTGCGCGAGGTGGTCGGCCGAGTGCTTCGGGCCTGGCGT GAGGAGGGTCTGATTCGCCAGGAACGCGGCCGCATCGTCATCCTGGACCGGGCCGCGCTG GAGAAGAAGGCTCAAATCTGACATCATTCGTGCCAGGACGAGTTATGCAAAGATGTCAGG AAAAAGGACTTTTTGACAAAGAGAGGGGAATATGCTACATTGTCAGCCCCGGAGGGCCGG CCCGCATGGACCAACCGCATCCGGGTGACCCGAAAGGCAGAAACGTTCGGGCAGGCTGAT GATGGACACGTTCCGCGCCATCCGTCGGGTCCTCTGGATCACGATGGGGCTCAACCTTCT GGCTATGGCGGCCAAACTGGGCGTGGGCTACCTCACCGGCTCCCTCAGCCTGGTCGCCGA CGGCTTCGATTCGGCCTTTGACGGTGCCTCCAACGTGGTGGGGCTGGTGGGGATTTATCT GGCCGCCCGACCGGCCGACGAAGGCCACCCCTACGGCCACCGCAAGGCCGAAACCCTCAC CGCCCTGGGCGTCTCCGCCCTCCTCTTCCTGACGACCTGGGAACTGGTGAAGAGCGCGGT CGAGCGCCTGCGCGACCCGACTCGGATACAGGCCGAGGTCACGGTCTGGAGTTTCGGGGC CCTCGTCCTCAGCATCCTGGTGCACGCGACCGTGGTCTGGTACGAGATGCGGGAGGGCCG GCGGTTGAGGAGCGATTTCCTGGTGGCCGATGCCCAGCACAC
After so much time working on this data, it was pretty exciting to see the actual site.

I came back to the research station with Albert and Bo, and I fixed some lunch for everyone (apples and pears with Nutella, cheese and black bread, olives, some cucumbers sliced with lemon and dill, and the ubiquitous Russian sausage for the meat eaters).

After lunch, everyone except Bo went back to Zavarzin (Bo stayed at the station to work on the electrodes for his instrument). Albert and Sarah took measurements and tried out some home-made core samplers, and Anna and Alex started some enrichment cultures. This was a preliminary trip, so I mostly just tried to stay out of the way. I got some nice photographs of the rather extraordinary microbial mats growing in the smaller springs nearby.

I mentioned in a previous post that volcanic liquids are very diverse; this is the reason it's worth traveling all the way to Kamchatka. Here is a nice example of what I was talking about. These are three springs within about four feet of each other. You can see just by looking at them that they are different. The colors range from in clear to white to gray, indicating different redox states (probably of sulfur); the temperature ranges from 91C, to 86C to 81C, and the pH from 7 to 5.6 to 6.1.


Three adjacent yet very different springs.

That might not sound particularly dramatic, but recall that when you catch a fever, the shift from 37 degrees to 39 degrees is enough to halt the growth of a wide array of organisms. This is why fever is a response to infection. Microbes often adapt to very particular circumstances, and so a change of a few degrees can shift the ecology dramatically, or replace it altogether. As environments, these three springs are as different from each other as the inside of your mouth and the eyelid of a duck.

We finished up with our poking around at Zavarzin, and came home for a dinner of Borscht prepared by Anna. It was delicious. After dinner, we started setting up our lab space upstairs for DNA extractions. I managed to trip the breaker on the generator several times trying to charge up the UPSs.

Updates, continuing

Posted by Russell on August 15, 2010 at 4:59 p.m.
My apologies for getting behind on posting my updates from Uzon. After we returned from Uzon, we rested for a day, and then crammed ourselves and our equipment into a van and went to Peratunka for the Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles international workshop, where I was scheduled to give a 20 minute talk.

The speaking docket got shuffled around a lot, and I ended up having to give my talk much earlier than planned. I suppose this is the inevitable downside of procrastination. While I was scrambling to finish it, I didn't have much time for blog updates!

I survived the talk. There were lots and lots of excellent questions, and I have a lot to think about now. Anyway, back to the updates from Uzon.

Uzon, Day Zero

Posted by Russell on August 12, 2010 at 8:25 a.m.
We were picked up by a mini-bus taxi from our apartment in Petropavlovsk, only to have to turn around to retrieve a forgotten jacket whose owner shall remain nameless. From there, we drove to Kronotsky Nature Preserve, and met up with a bunch of other people including Shpilenok, the director of the preserve, a Russian TV station crew, and some photographers. Also aboard was a group of people that included the granddaughters of Tatiana Ustinova, the woman who discovered the Valley of the Geysers with Anisifor Krupenin in 1941.

The discovery of the valley is an adventure all unto itself -- beginning with a dogsled trip that got off track and ending up with the discovery of first hydrothermal site in Russia. Tatiana, who eventually settled in Vancouver, passed away recently. Her family was aboard our helicopter on a visit in her memory to Geyser Valley. Her valley, one could say.

Frank spent much of our time in Petropavlovsk regaling us with stories of helicopters left over from Russia's war in Afghanistan and held together with bits of string. If our helicopter was that old, it has been lovingly maintained.


Our ride to Uzon touching down at the airfield.

I was expecting the ride itself to be exciting, but there is none of the rush and acceleration of an airplane takeoff; when a helicopter takes off, it gets very, very loud, and rises with all the grace and charm of a freight elevator. The excitement came entirely from the view out the portal, which we could open. Kronotsky Nature Preserve is spectacularly beautiful from any angle; as interesting as it was to see it from the air, I kept wishing we would land so I could get out and have a look around.


The view from the helicopter portal as we entered Kronotsky Nature Preserve.

I lost track of how many volcanoes we passed. The most exciting was Karimsky, which happened to erupt just as I snapped a picture of it!


Karymsky Volcano erupting as we fly nearby.

Actually, I didn't take this picture. There was a photographer sitting next to me using the same portal, and I had asked him to snap a few shots of Karimsky -- which was not erupting at the time -- because he had a better angle from were he was sitting. He snapped one shot of the volcano and gasped, and then dropped my camera in his lap and grabbed his own.


Karymsky Volcano erupting as we fly nearby.


Eruption of Karymsky Volcano continues as we fly over an inland delta.

We touched down in Uzon Caldera a few minutes later, and immediately ran into some confusion over accommodations. There are two buildings in Uzon Caldera; a ranger station, and the research station. The structures are each about the size of a modest single family home. There was already a team from Winigradsky Institute staying at the research station (the director, actually), as well as the ranger and an entomologist. Meanwhile, the ranger station is being renovated, and the work crew is staying there.


Our ride continuing on to Geyser Vally. The family of Tatiana Ustinova were aboard.

The helicopter crew had been told that we would be staying at the ranger station for some reason, and so the earlier flight had delivered all of our food and lab equipment to the landing pad nearest the ranger station. The ranger station is about a kilometer away from the research station, and so we had to schlep all thirteen boxes of lab equipment and four heavy boxes of food.


Shifting our food and lab equipment from the ranger station to the research station. It was a long and exhausting job.

Once installed at the research station, Sarah, Bo and I organized our gear and luggage, and Frank and Albert -- dead tired, like the rest of us -- went upstairs bearing gifts to make friends with the other research team.

We rehydrated some freeze-dried pasta primavera, to which Sara and I added tofu. I was too hungry to notice what everyone else ate, but I think sausage was involved. Then we passed out.

Back from Uzon

Posted by Russell on August 10, 2010 at 8:49 p.m.

Panorama overlooking Orange Fields in Uzon Caldera

We just arrived back in Petropavlovsk after a week in the field. I was very sad to leave Uzon, and it was a privilege and an honor of the highest order to have spent those days there.

The expedition was, I think, a great success. We'll know for sure once we're back at our labs and can use more sophisticated methods to examine our samples. I am very confident, though.

It was a bit touch-and-go right at the end. Our high speed centrifuge crapped out last night, just as Sarah was in the middle of the last big run of DNA extractions. The Russian team brought their own centrifuge, but we couldn't run it on our generator. Much to our relief, Albert was able to magically get the thing working again by holding it at just the right angle. They worked through the night to finish processing the samples; I think Albert must have had his thumb wedged under the centrifuge for the entire run.

I'm sorry I wasn't able to send many Twitter updates toward the end of the expedition. Once I had identified my sampling targets, I suddenly had a lot less free time on my hands (and I didn't have much to begin with). Also, I'm sorry for updating in ALL CAPS. Iridium handsets are essentially 1993 technology. Composing text messages is extremely painful, and the battery only lasts long enough to compose two or three of them. This is a pain when you have to recharge on generator power, and the generator only cranks up for a few hours a night, and even then only to power lab equipment for DNA extractions. Hats off to my dad for relaying the messages!

Right now, I'm sitting in a friendly internet cafe in Petropavlovsk where they've let me use their wireless connection. When we arrived at our crowded little apartment, the hot water was broken, and thus no showers yet. A wide selection of interesting geologic samples are wedged under my fingernails, and I think I have wads of some sort of hardened liquid sulfur caked in my hair. The helicopter arrived ridiculously early, and we just barely get everything aboard. As a result, I'm still wearing my field clothes from yesterday, which are splattered with volcanic mud. I may actually be the worst-smelling person in Petropavlovsk. Perhaps it is fortunate that this internet cafe caters mainly to kids playing StarCraft.

I composed blog entries for each day we were in Uzon, and I'll be posting them as soon as I run them past the rest of the team. I also have almost two thousand photos to sort, tag and upload.

That said, I have a correction for one of my Twitter updates. I wrote :

YERTERDAY ALBERT & TEAM WERE CHASED AWAY FROM A SITE BY A BEAR THAT WAS ACTUALY A BUSH IN THE FOG.
Albert pointed out that they were interrupted for a few minutes, but not actually chased away. He stepped forward and shouted see if he bear (or bears) would go away, with his signal torch uncapped and ready. The bears were revealed to be bushes as the wind shifted and created a channel in the mist. It's funny, but given how foggy it was that day, it wasn't actually that surprising. We were at the same site the next day, and were surprised by an actual bear. It wandered pretty close to us before we could actually see it (the full story will come with the article for that day).


A bear interrupting important EisenLab work at Boiling Spring.

Update : Albert also says that I'm wrong about having to wedge his thumb under the centrifuge the whole time. It started working again after shaking it around in the air a bit, and placing it just so on the table. He only had his thumb wedged underneath it for a minute or two to check to see if it was overheating.

Last minute preparations

Posted by Russell on August 04, 2010 at 5:10 a.m.
We're planning to return from Uzon on the 11th of August, so assuming we leave this evening, we'll be there for seven days. We have to plan for the possibility that we might get fogged in up there, so we might be stuck for a few extra days. Hopefully that won't happen, because we've got a workshop to prepare for once we get back. Also, I've picked up a bad habit from Jonathan, and I still have to write my talk for the 17th.

We had an exhausting day yesterday.

First, the cost of the helicopter has gone up since last time they made the trip, so Frank and Albert had to arrange to transfer the difference from America to Petropavlovsk. This turned out to be an agonizing process, and I'm not even sure of all the details. Albert came back to the apartment after the first day of working on it and passed out instantly. Suffice it to say that both of them have extremely patient and resourceful spouses, without whom we would now be stranded in town with no way to get to our research site.

There remains a great deal of confusion and uncertainty about the status of the generator (or generators?) at Uzon, and so we've had to prepare for the worst. I spent the day with Albert and Alex hunting down motor oil, spark plugs, and two-stroke oil (in case it's a two-stroke engine), and other small-engine stuff. Supposedly there is a new American-market Honda generator up there, a Soviet-era machine that can still be persuaded to work, and perhaps something else of unknown providence and status. We were also told that there was no generator at all, sending us scrambling all over town to buy a new generator, but that was evidently a misscommunication. Fortunately we got it straightened out before we actually started laying out Rubles for the first generator we could carry away!

In the summertime, the research station would be a truly ideal place for an off-grid solar array. One of the things I'm going to do while I'm there is to study the structure an write up a proposal for its owners to install one, if they should so desire.

After much looking around I found that, nobody sells regular fuel canisters for backpacking stoves in this part of Russia. However, they do sell adapters that let you plug them into butane refill canisters. The canisters are very cheap, but they are shaped like cans of hairspray; narrow and tall. Not a very stable platform for cooking! I'm going to set up my stove in a bucket, and pack dirt around the fuel canister to keep it stable and upright (and far from anything that might melt or burn). And yes, I'll only use it outside.


Demonstrating the use of mosquito protection gear for Bo -- you can tell I'm not really excited about mosquitoes

I was able to find a SIM card for my MyTouch 3G, which is awesome. Unfortunately, MTS doesn't know how to automatically configure Android phones for GPRS. At least, that's what I could understand from the girl at the MTS store. That conversation was conducted mostly through hand gestures and giggling, and was a testament to the power of technology-related acronyms to puncture language barriers. It's strange to say, "IP for DNS server?" and see the light of understanding spread across a person's face.


We bought more than 15,000 Rubles of food for the trip! Actually, that's pretty reasonable for seven people.

Last of all, there was the food. By the time we all got to the grocery at 7:00 in the evening, we were almost totally spent. Still, we had to shop for another two hours before we had everything we need (at least, I hope we have everything we need).

This morning a truck from the Institute arrived at the apartment to pick up our food and laboratory equipment. We're not totally sure if we will be riding with it to Uzon, or if it will go on a separate helicopter. So, we had to waterproof everything last night in case it had to spend the day (or evening) on the landing site in the rain. I am glad we had plenty of plastic bags and tape!


Our food and lab equipment getting picked up

With luck, we will catch our helicopter to Uzon this evening.

Uzon field season team, 2010

Posted by Russell on August 01, 2010 at 9:24 a.m.


Professor Frank T. Robb, University of Maryland

Frank is the co-chair of the workshop, and is leading our expedition. Frank is a regular in Uzon Caldera, and has made several expedition to the site since 1995.

Frank has been studying thermophiles for around twenty years, including their physiology, genomes, proteins, and ecology.


Professor Albert Colman, University of Chicago

Albert is organizing the expedition this year, and has accompanied Frank (and others) to Uzon several times. Albert was Frank's graduate student back in the day.


Alex Merkel, Winogradsky Institute of Microbiology

Alex graduated from Moscow State University, and is now a Ph.D. candidate at the Winogradsky Institute of Microbiology in Moscow. He is studying the functional diversity of methanogenic genes and culturing methane producing microorganisms.

He is also secretly the lead singer from Coldplay.


Anna Perevalova, Moscow State University

Anna graduated from Moscow State University and obtained her Ph.D. from Winogradsky Institute of Microbiology in Moscow. She is now a postdoctoral researcher at Winogradsky. Her specialty is growing extremely difficult organisms, and she also works with Alex on methanogens.


Sarah Griffis, Caltech and University of Chicago

Sarah is a senior at Caltech, and has been working in Albert's lab in Chicago for the summer doing DNA extractions.


Bo He, University of Chicago

Bo is a graduate student in Albert's lab; he studies the electochemistry of cellular redox metabolism, particularly as it pertains to metal chemistry. He did his MS at Chapel Hill on the kinetics of iron III and hydrogen sulphide in sediment formation. It's nice to have someone with a physical sciences background along for the trip!


Russell Neches, University of California, Davis

And, of course, me.

Live from Petropavlovsk

Posted by Russell on August 01, 2010 at 8:18 a.m.


Singlehandedly bringing PLoS to new frontiers!

I arrived safely in Petropavlovsk yesterday after a very long layover in Khabarovsk and an even longer layover in Vladivostok. Frank Robb and Alex Merkel met me at the gate, and we wobbled off with our driver to the Volcanology Institute to file my paperwork.


Beer! Where have you been all this time?

After dropping my stuff off at the apartment, Frank took everyone out for pizza. Airport and airline food in Russia leaves a bit to be desired, especially if you are vegetarian and don't speak Russian. Pretty much everything is covered in, stuffed with, or made entirely out of sausages.

I basically hadn't had anything to eat in 24 hours, so I was extremely glad to get my hands on the pizza (I ate almost two). The beer was also extremely welcome.


Fog, cursed fog.

Unfortunately, Petropavlovsk is fogged in with what everyone keeps caling a "cyclone," but I don't think the word is used in the same sense as I'm used to. It seems to be a huge fog bank with drizzle coming in from the ocean. The helicopters we will fly to Uzon Caldera are fly-by-sight, so we're grounded in Petropavlovsk until the weather clears.

For now, it's seven scientists crammed into a tiny one-bedroom Soviet era apartment with a dozen laptops, piles of camping gear, and two whole laboratories (one for geochemistry, one for recombinant DNA) stuffed into freight boxes. Time to go exploring...


The door to Petropavlovsk; due for a little maintenance

Kamchatka for those who've never played Risk

Posted by Russell on July 27, 2010 at 1:30 p.m.

Anyone who's played Risk will probably remember Kamchatka as "That place you can attack Alaska from." Like most of the territories in Risk, Kamchatka of the Hasbro game doesn't exactly match its modern political boundaries :

However, the Risk territory does reflect the range of the Chukotko-Kamchatkan language family, which includes the language spoken by the Koryaks (Kamchatka's indigenous people) :

400,000 people live on the peninsula, and about 13,000 are Koryak (about 3%). For comparison, Alaska has about 686,000 people, of which roughly 100,000 (15%) are native peoples. In terms of population, the Koryaks' situation more closely resembles that of the Ainu of Hokkaido (also about 3% of the population, going by self-identification) than native Alaskans.

Kamchatka has volcanoes. Lots and lots of volcanoes. It's part of the Ring of Fire, with 160 volcanoes, 29 of which are active. The whole area is seismically active, and there was a decent-size quake off the coast just this Sunday.

Phil Plait at Bad Astronomy posted about an this awesome photo of two Kamchatkan volcanoes erupting at the same time. It was captured in February, 2010 by NASA's TERRA Earth-observing satellite as it flew over (the TERRA website appears to be down right now - this isn't rocket science, NASA!).

These volcanoes, and the microbes that live in and around them, are the reason why we're traveling around the world to see this place. Wherever magma is close enough to the surface to interact with groundwater, superheated steam can be forced toward the surface. Depending on the how much it cools before reaching the surface and the pressure under which it emerges, the liquid can for a variety of hydrothermal features; geysers, fumaroles and springs if the liquid emerges on land, and black smokers and white smokers if it emerges under water.

Along the way, the water dissolves various minerals and gases from the rock, and catalyzes the formation of new minerals and gases. By the time it emerges at the surface, it has become a complex suspension of minerals, gases and liquids, some dissolved, others suspended as a colloid, and others in bubbles and grains. I'm going to stop calling it "water" and call this stuff "volcanic liquid."

The chemistry of the emerging liquid depends on the chemistry, temperature, depth, thickness, packing and order of each layer of rock and soil it transits on the way to the surface, as well as the pressure and temperature of the liquid at each step along its journey.


A thermal pool at Lassen Volcanic National Park

My favorite way to explain how there could be so much variety in volcanic liquids is to think about coffee. It's possible to make several very different kinds of coffee from the same beans. If you grind them very fine, pack them tightly, and force steam through the grounds at high pressure, you get espresso. If you grind them even finer and suspend them in hot water as a colloid, you get Turkish coffee. If you grind them coarsely, suspend them in water, and remove them with a sieve, you get French-style coffee. If you grind them moderately, put them in a filter cone, and pour hot water through them, you get American-style drip coffee. They each taste totally different, despite being made from exactly the same ingredients.

Now, instead of coffee grounds, imagine many layers of rock, each with different chemistry, packing density, and thickness. Rocks, by the way, are pretty complicated things, and can be made out of almost anything. Practically every source of volcanic liquid from around the world has a unique chemical composition.

This variety is one of the reasons microbiologists are so interested in the organisms that live in these liquids. Organisms that live in the Earth's atmosphere, like you and me, have only a few attractive options for how we run our metabolisms. For organisms that live in volcanic liquids, every combination of dissolved and suspended minerals and gases offers its own unique metabolic opportunities. Volcanic structures tend to persist for a long time, and so their denizens have time to evolve very well-adapted strategies for living in these places.

Visiting these volcanic vents is like taking a trip to an alien world, or like visiting Earth when it was a radically different planet. Volcanic zones don't just look alien, they are alien!


An alien habitat at Lassen Volcanic National Park

I will be spending almost two weeks up-close-and-personal with some of these alien habitats, so there will be more to come.

Science, the practice of

Posted by Russell on July 25, 2010 at 6:40 a.m.

This is the first in a series of articles I plan to write over the next three weeks covering my field expedition to Uzon Caldera and attendance the 2010 International Workshop on Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles. In this post, I'll outline my plans for the series and explain why I'm writing it.

If you would like to follow along, check in here, or subscribe to my RSS feed. Or if you would like to follow the series and not the rest of my blog, I will be tagging all of the posts in the series kamchatka. At Uzon Caldera, I will be posting updates to my Twitter feed by satellite phone (you can also subscribe to my Twitter RSS feed.)

Before I leave on Tuesday, I will post articles introducing the natural history of Kamchatka, my plans and preparations for getting getting there and working there, and maybe a few other things.

I have two broad goals :

  • Study the biochemistry, genomics, and physiology of thermophilic organisms in their natural habitat.
  • Document and share the experience.
These are two fairly distinct missions. First of all, I'm looking for material for my thesis, particularly a metagenomic target suitable for the technique I'm developing. For the hard science, I will try to confine myself to observations and avoid drawing conclusions. I'll save that for the journals.

The second mission is to bring you along. I've been asked by my thesis advisor to write about, photograph, tweet and film as much of the field expedition and the workshop as possible, and present it as an example of what it's like to actually do science. My goal is to present the company, the food, the work, the travel, the joys, the annoyances, the surprises, the good, the bad, and the ridiculous.

Science remains firmly misunderstood by the public. My personal experience suggests that the public actually understands the products of science -- powerful theories and key facts -- a bit better than polling data suggests. The core of public misunderstanding, I think, rests in how people believe science works as an institution and as a profession.

A couple of years ago, Fermilab invited a group of seventh graders to visit the laboratory to check out the various awesome things they have available for the public to see. Before the visit, the students were asked to write about what they thought scientists were like, and to draw a picture to go along with it. After the visit, they were asked to repeat the exercise. The results eye-opening. Here is an example I particularly liked, from a girl named Rachel :

before

after

Most of the before pictures feature lab coats filled by older, white men without much hair. Many of the kids mentioned that they thought scientists were "a little bit crazy," and most represented their scientist as some sort of authority figure. The after-visit results are equally interesting; many of the comments seem astonished that scientists have families, and that they enjoy things other than science.

The phrase "regular people" comes up again and again in their after-visit writing. Students are usually pretty good at ignoring phrases that are deliberately emphasized. When you see a bunch students incorporate exactly the same phrase into a free-form writing assignment, it's usually something that an adult mentioned without anticipating the impact it would have. The concept that scientists could be "regular people" was evidently a bit of a shock.

Obviously this is anecdotal, and it's important not to read too much into it. It is, however, a useful example of the sort of challenges we face if we want society to understand science itself, rather than simply memorizing the things science produces. None of this is original to me. If you want an entertaining treatment of science in the media, check out Christopher Frayling's Mad, Bad and Dangerous?: The Scientist and the Cinema (I apologize for the bizarre question-mark colon thing).

I've written about this before. Last November, I wrote :

The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.
Scientists have a responsibility to share what they do.

Over the next three weeks, I'm going to put that thought into action.

I'm going to Kamchatka!

Posted by Russell on July 19, 2010 at 5:47 p.m.
I just got the reservations for my flight to Petropavlovsk-Kamchatsky for the International Workshop on Biodiversity, Molecular Biology and Biogeochemistry of Thermophiles, hosted by Moscow State University and Winogradsky Institute of Microbiology.

I've been working on the analysis of environmental samples from two sites at Uzon Caldera (about 10,000 Sanger reads from each sequenced at the JGI), and I'm hoping that I'll be able to reprocess the DNA here at the UC Davis Genome Center using some of our high-throughput machines. Licensing and customs restrictions will probably make it impossible to bring my own samples back, but I may be able to entrust them to a colleague with fancier credentials than my own.

Insofar as it will be possible, I will be blogging from Kamchatka and uploading photographs and data, so please ask questions in the comments!

I'll be arriving in Petropavlovsk on the 30th of July, with the help of a generous grant from the Carnegie Institution for Science Deep Carbon Observatory.

Camping in Humboldt

Posted by Russell on July 01, 2010 at 3:24 a.m.
I went camping with some friends at Gold Bluffs Beach campground in Prairie Creek Redwoods State Park. It was pretty awesome.

Some books

Posted by Russell on June 30, 2010 at 4:42 p.m.
I've had unusually good luck picking books to read in the last few weeks, and I thought I would share my thoughts about a few of them. I don't really want to review them, because I think reviews are boring. If you want to know what a book is about, then read it. These are my unsubstantiated opinions.
  • The Windup Girl, Paolo Bacigalupi

    One of the most interesting and difficult challenges for contemporary science fiction writers is imagining the world after oil. Paolo Bacigalupi offers what I think is probably the most serious effort so far, though I think his calibration of technological progress (or lack thereof) is based more on media zeitgeist that anything else. Bacigalupi imagines an energy economy that has collapsed to human muscle power set alongside biotechnology of almost arbitrary power. It makes for a very unique world, and he accomplishes some pretty excellent storytelling. The story layers melancholy reflection with fast-paced action, but remains tightly cohesive.

  • Ship Breaker, Paolo Bacigalupi

    Ship Breaker seems to be set in the same world as The Windup Girl, but follows a single protagonist, rather than a cast of characters. Ship Breaker paints Bacigalupi's imagined history in clear strokes, whereas The Windup Girl paints it with hints, unexplained references, and frayed ends that the reader must patch together on their own. Ship Breaker is more brutal but less bleak.

  • For the Win, Cory Doctorow

    If you've ever played video games, you need to read this book. If you've ever read anything by Howard Zinn, you need to read this book. If you were paying any kind of attention to the Financial Crisis, you need to read this book.

    For the Win is a battle between two brilliant economists, a labor organizer from India and a Stanford-dropout quant from America. Doctorow highlights the astute observation that game economies are steadily becoming larger and more sophisticated, while the proliferation of credit default swaps, collateralized debt obligations and other various unregulated instruments have made our financial system more like a giant video game. They are linked; Doctorow merely imagines the link has grown deeper and more complex. The battleground of the book is the murky, crime-ridden middle ground shared by hedge fund managers, dark knights, child laborers, derivatives traders, Chinese crime bosses, bored American teenagers, and hundred-foot-tall zombie death robots. It's brilliant.

  • Generation A, Douglas Coupland

    I never know if I should classify Coupland with Don DeLillo or with Neal Stephenson. His books thrive on the knife's edge between postmodernist absurdism applied to reality, and literate, profane realism applied to science fiction. Postmodernism places the rupture with reality in the interpretation of the world, and science fiction places the rupture in the world itself. Coupland's narratives exist somewhere between these two, and the effect is like looking into someone's eyes from up close, when the parallax is big enough that you waver from one eye to the other. The rupture slips back and forth between the interpretation and the world, and the effect is delightful.

  • City at the End of Time, Greg Bear

    This book is worth reading for the atmosphere alone. The plot is an introspective adventure across dreams and time, and but the texture is what really sells it. If you appreciated the textured melancholy in Lord of the Rings or The Silmarillion, then City at the End of Time is definitely worth reading. Greg Bear raises the stakes and invokes the senses in a very different way, but the mood is like a Tolkien piece.

    A common theme in literature is the cruelty of time and decay. City at the End of Time confronts this directly, emphasizing the joy of time and change, and the horror of the alternative. Like Tolkien, the atmosphere creates a kind of intense nostalgia for the here and now.

  • The Android's Dream, John Scalzi

    John Scalzi must have enjoyed writing this book enormously, and it shows. Every couple of pages culminates in a laugh-out-loud idea. It's brazenly ridiculous, but isn't as manic as Douglas Adams or Terry Pratchett. Scalzi seems to enjoy building up his absurdities into towering edifices, rather than sprinkling them around. They're not just funny in themselves; they're funny because Scalzi manages to pull them off.

  • The Immortal Life of Henrietta Lacks, Rebecca Skloot

    This is probably one of the most important books of the year. Rebecca Skloot is thoughtful, compassionate and brilliant, and she put more than a decade of work into this slim little book. If it were fiction, it would be a brilliant accomplishment, but this is as real as it gets. This is a beautiful personal narrative, an ethics lesson, a call to action, a carefully documented historical account, an adventure, a science lesson, and a cogent critique of the culture of medical practice and research. If Skloot had pulled off only one or two of those things, this would still have been a brilliant book.

    It is clear that she cares deeply about the Lacks family, and when you're done with this book, so will you.

Good luck, whoever you are

Posted by Russell on June 08, 2010 at 3:54 p.m.
Last week, I got an urgent call from the National Marrow Donor Program. Somewhere, there is a girl about to go into chemotherapy, and my tissue type matches hers. They needed to run some more detailed tissue typing, and screen for infections diseases. The NMDP sent a kit to the UC Davis student health center (the new building is right next to my house), and I had my blood drawn this morning.

I hate giving blood. They didn't need very much, but I don't get along very well with steel needles. I count it as a major victory that I didn't barf until I got home.

Now we all wait for the results.

Good luck, whoever you are.

20s

Posted by Russell on May 31, 2010 at 9:17 p.m.
To steal the idea from John Scalzi, here is the last photograph of me in my 20s.

My twenties; better than my teens. Some good times, and some pretty awful times, and on average kind of meh. If the trend holds, my thirties should be in the tolerable to nice range. Hopefully the underlying process is geometric, and not linear or logarithmic.

Hence the awkward sort of half-smile.

Holly Allan-Young

Posted by Russell on May 26, 2010 at 10:57 p.m.

Terry Young: She is gone
Sent: 2:54PM
I will miss her terribly.

New ceramics

Posted by Russell on May 21, 2010 at 7:36 p.m.
I just retrieved my latest ceramics from the studio today, and I'm really happy with how they turned out. This is the first four of a series of twelve pieces glazed the same way, with a turquoise underglaze, a vibrant blue topglaze, and a buff-mix claybody with an aluminum oxide treatment.

This is my favorite piece, and the largest thing I've finished so far. It holds about 1400 ml. It's a little big to eat out of, but a little too small to really use as a serving bowl. I think I will use it mostly as decoration, but it could make a nice serving basin for two people, or maybe for serving a side dish, or something like that.

Now I have six more things to finish before the quarter is over!

What Google knows

Posted by Russell on April 28, 2010 at 11:26 a.m.
After six months of using Google Latitude, I've amassed about 7108 location updates, or about 38 a day. It would probably be a lot more if I hadn't managed on occasion to break the GPS or automatic updating by fiddling with the software.

It's actually quite useful to have this data, especially if it's correlated with some richer information. For example, I've consulted the data to answer questions like, "Where was that awesome sandwich place I ate at last month?" It's also extremely useful to be able to share this data with Google because it allows me to quickly cross-reference location coordinates with Google's database of businesses and addresses. You can also download your complete location history in one giant blob (just ignore the warning that the History map only displays 500 datapoints, and download the KML file). Once you have the KML file, you can do whatever you want with it. For example, I uploaded mine to Indiemapper to map my wanderings for the last six months (Indiemapper is cool, but I quickly found that this dataset is really much too big for a Flash-based web application).

Not surprisingly, I spent most of my time in California, mostly in Davis and the Bay Area, with a few trips to Los Angeles via I-5, the Coast Starlight, and the San Joaquin (the density of points along those routes is indicative of the data service along the way).

The national map shows my trip to visit my dad's family in New Jersey and Massachusetts, as well as a layover in Denver that I'd completely forgotten about.

I have somewhat mixed feelings about this dataset. On one hand, it's very useful to have, and sharing it with my friends and with Google is very useful. It's also cool to have this sort of quantitative insight into my recent past so easily accessible. On the other hand, I'm not particularly happy with the idea that Google controls this data. I chose the word controls deliberately. I don't mind that they have the data -- after all, I did give it to them. As far as I know, Google has been a good citizen when it comes to keeping personal location data confidential. The Latitude documentation makes their policy pretty clear :

Privacy

Google Location History is an opt-in feature that you must explicitly enable for the Google Account you use with Google Latitude. Until you opt in to Location History, no Latitude location history beyond your most recently updated location if you aren't hiding is stored for your account. Your location history can only be viewed when you're signed in to your Google Account.

You may delete your location history by individual location, date range, or entire history. Keep in mind that disabling Location History will stop storing your locations from that point forward but will not remove existing history already stored for your Google Account.

...

If I delete my history, does Google keep a copy or can I recover it?

No. When you delete any part of your location history, it is deleted completely and permanently within 24 hours. Neither you nor Google can recover your deleted location history.

So, that's what they'll do with it, and I'm happy with that. What bothers me is this: Who owns this data?

This question leads directly to one of the most scorchingly controversial questions you could ask for, and there are profound legal, social, economic and moral outcomes riding on how we answer it. This isn't just about figuring out what coffee shops I like. If you want to see how high the stakes go, buy one of 23andMe's DNA tests. You're giving them access to perhaps the most personal dataset imaginable. In fairness, 23andMe has a very strong confidentiality policy.

But therein lays the problem -- it's a policy. Ambiguous or fungible confidentiality policies are at the heart of an increasing number of lawsuits and public snarls. For example, there is the case of the blood samples taken from the Havasupai Indians for use in diabetes research that turned up in research on schizophrenia. The tribe felt insulted and misled, and sued Arizona State University (the case was recently settled, the tribe prevailing on practically every item).

You can't mention informed consent and not revisit HeLa, the first immortal human cells known to science. HeLa was cultured from a tissue biopsy from Henrietta Lacks and shared among thousands of researchers -- even sold as a commercial product -- making her and her family one of the most studied humans in medical history. The biopsy, the culturing, the sharing and the research all happened without her knowledge or consent, or the knowledge or consent of her family.

And, of course, there is Facebook -- again. Their new "Instant Personalization" feature amounts to sharing information about personal relationships and cultural tastes with commercial partners on an op-out basis. Unsurprisingly, people are pissed off.

Some types of data are specifically protected by statute. If you hire a lawyer, the data you share with them is protected by attorney-client privilege, and cannot be disclosed even by court order. Conversations with a psychiatrist are legally confidential under all but a handful of specifically described circumstances. Information you disclose to the Census cannot be used for any purpose other than the Census. Nevertheless, there are many types of data that have essentially no statutory confidentiality requirements, and these types of data are becoming more abundant, more detailed, and more valuable.

While I appreciate Google's promises, I'm disturbed that the only thing protecting my data is the goodwill of a company. While a company might be full of a lots of good people, public companies are always punished for altruistic behavior sooner or later. There is always a constituency of assholes among shareholders who believe that the only profitable company is a mean company, an they'll sue to get their way. Managers must be very mindful of this fact as they navigate the ever changing markets, and so altruistic behavior in a public company can never be relied upon.

We cannot rely on thoughtful policies, ethical researchers or altruistic companies to keep our data under our control. The data we generate in the course of our daily lives is too valuable, and the incentives for abuse are overwhelming. I believe we should go back to the original question -- who owns this data? -- and answer it. The only justifiable answer is that the person described by the data owns the data, and may dictate the terms under which the data may be used.

People who want the data -- advertisers, researchers, statisticians, public servants -- fear that relinquishing their claim on this data will mean that they will lose it. I strongly disagree. I believe that people will share more freely if they know they can change their mind, and that the law will back them up.

Update

The EFF put together a very sad timeline of Facebook's privacy policies as they've evolved from 2005 to now. They conclude, depressingly :
Viewed together, the successive policies tell a clear story. Facebook originally earned its core base of users by offering them simple and powerful controls over their personal information. As Facebook grew larger and became more important, it could have chosen to maintain or improve those controls. Instead, it's slowly but surely helped itself — and its advertising and business partners — to more and more of its users' information, while limiting the users' options to control their own information.

Comcast melts in the rain

Posted by Russell on April 20, 2010 at 10:57 p.m.
For reasons I do not wish to fathom, my internet connection from home sucks whenever it rains. When I try to imagine why this might be the case, it calls to mind some truly horrifying images of what might be going on in Comcast's wiring closets.

How much does it suck? Well, here is a histogram of 200 ping times from my house to a machine at UC Davis, about 3000 feet from my front door. For comparison, I simultaneously collected 200 pings from my colo machine, which is 3000 miles away in Boston. The inbound and outbound packets from the colo go over Level3, so I've labeled it thusly.

Now, I wouldn't really expect a residential cable modem connection to measure up very well against a colocated server in terms of latency, but this isn't just a failure to measure up. This is just a regular old fashioned failure.

What ticks me off the most is that I pay $636 a year for this crap, and that my only alternative is AT&T DSL. I'd rather shave my tongue with a used bayonet than see a penny of my income fall into the hands of AT&T. Why does broadband suck in America?

I believe, Sir, that I may with safety take it for granted that the effect of monopoly generally is to make articles scarce, to make them dear, and to make them bad.
- Thomas Babington Macaulay

A desirable extinction

Posted by Russell on March 25, 2010 at 3:19 p.m.
Some weeks ago, Buzz (my cat) escaped out my front door while I was carrying my bicycle into the apartment. For ten or twenty minutes, he romped through the ivy and bushes around my apartment while I followed him around rattling a bag of cat treats. Eventually, he let me pick him up and take him back inside. Naturally, he picked up a few fleas. Naturally, they have multiplied.

Oddly, the fleas don't seem to like Neil very much, nor do they like me. It's just poor Buzz that's beset by the nasty little critters.

Figure 1: A flea.


As it happens, I've been thinking about endogenous metrics for estimating the sampling quality of an environmental shotgun sequencing dataset, and Buzz's little problem presented an opportunity to play with a simplified problem. So, I have decided to make Buzz, or rather his fleas, into a small experiment in ecology. I am going to try to see if I can drive them into extinction.

Now, this is normally what a pet owner does when they discover their pet has contracted some sort of annoying parasite, but I decided to take a more quantitative approach.

Figure 2: A cat.


It's simple enough to count fleas on a cat, if the cat is willing to cooperate. Buzz loves the flea comb, and will gleefully hop onto the coffee table and wait to be combed if you show it to him. So, in the interest of science, I convinced my roommate to count the number of passes I made with the flea comb and how many fleas I captured (posterity will remember your efforts, Mehdi). Using his tally, I plotted the cumulative number of passes verses the cumulative number of fleas.

Figure 3: Fleas captured

As expected, it became somewhat more difficult to capture the next flea as more fleas were captured, suggesting a depletion curve. The value of the asymptote should be the actual number of fleas on Buzz at the time, and reaching that number would imply local extinction for the fleas. Of course, there are probably other fleas lurking about that would recolonize Buzz. In principle, if I were to repeat the exercise frequently enough, Buzz would become a sink for fleas, and their migration to his fur would gradually deplete them from the environment.

There are a couple of different ways to model the impact of the combing on the flea population, with various advantages and disadvantages. All we really want to do here is to estimate the value of the asymptote, and so a simple model is probably sufficient. I showed this data to my fried Sharon Shewmake, an economics graduate student. Sharon, after editorializing on the endeavor ("Ew."), suggested this very simple model.

Assume that Buzz is not going to sit still long enough for the fleas to reproduce, for more fleas to migrate to his fur, and that the fleas already on his fur are going to stay put unless captured. Thus, there is a fixed initial population which only changes as a result of capturing fleas. Next, we assume that any given flea is equally likely to be captured on a single pass of the comb. So, the expectation value for number of fleas captured on a single pass is the product of the current population and the probability of capturing a flea.

where N is the population of fleas and p is the probability of any particular flea being captured on a single pass. One could tart this up a bit by modeling it as a stochastic process and executing a bunch of Monte Carlo trials until the outcomes converge, but that seems like overkill for a simple single variable problem like this. We will put up with the intellectual inconvenience of capturing fractional fleas.

This is a little easier to see if we let N represent the number of fleas remaining on the cat, rather than the number of fleas captured.

If we stretch our credulity far enough to imagine this as a continuous function, we can express it as a differential equation.

Sorry if this bothers you. Not only are we extracting fractional fleas, but we are now modeling the combing process as a sort of flea-killing-combine continuously mowing its way through the fur. This is a model, so you shouldn't be surprised to find massless rope and spherical cows. Anyway, it has a nice easy solution.

Well, what the heck. This is a decaying function, so let's pluck a minus sign out of the exponential factor, and maybe tack on a scale factor for the initial population.

While we're at it, why don't we go back to letting the function stand for the number of fleas captured, rather than the fleas on the cat.

This gives us a nice function to use for a linear regression. A little help from scipy, and we find that the initial population is estimated at 39.7 fleas, and the decay factor is 0.011.

Figure 4: Flea population

I captured 34 fleas, so that means I missed about five or six. In order to be reasonably confident that I'd captured all 39 fleas, I would have had to continued for about 400 passes with the comb, instead of 173. Buzz is a patient cat, but he started to loose interest around 120 passes, and had to be fetched back onto the coffee table a few time times during the last 50 passes. My guess is that 400 passes would require some kind of sedative. On the other hand, he does seem to like Guinness, so there may be something to that.

Science has been served. I'm going to the pet store to buy some flea collars.

Espresso

Posted by Russell on March 13, 2010 at 3:56 p.m.
A few weeks ago, my dad sent me this really nice espresso machine to cheer me up. Actually, he sent it to me because it was it was his birthday. He's a pretty awesome dad that way -- I only sent him a book.

I'm still getting the hang of getting a decent pull of espresso out of it. I've found that my burr grinder doesn't quite go fine enough for espresso, so I'm going to have to take it apart and see if I can adjust the grinding wheels so they're closer together. Anyway, here is my latest effort :

TJ's is coming to Davis

Posted by Russell on March 07, 2010 at 9:04 p.m.
Somehow this escaped my notice. Trader Joe's is building a new store in Davis! And right across the street from me, no less. Hurry up and bring the good eats, TJ's.

Owls!

Posted by Russell on March 03, 2010 at 12:13 p.m.
To my surprise, I learned this weekend that Davis has a lively population of burrowing owls, Athene cunicularia. How cool is that?

I took some nice shots, but Jonathan has a 300mm zoom, and I don't.

They're one of the few species of owl that is active during the day, though I think these guys were only awake to watch various chattering bipeds on the hiking trail. They seem comfortable with people getting within about 30 feet of their burrows, so you can get pretty close. If you go any closer, they start to do the "I don't like you" dance. If you ignore the display and keep getting closer, I'm not sure if they would run into their burrows or have at you with their claws and beaks. Owls will mess you up, even these little guys. At least they're polite enough to warn you, so heed the warning.

Facepaw

Posted by Russell on February 10, 2010 at 3:42 a.m.
Spent the day writing a piece of code I already wrote six months ago. Not sure how I managed to forget. The new code wasn't very good, so I threw it away. Day down the tube.

Even asleep, Neil seems to understand.

Cat replenishment

Posted by Russell on February 09, 2010 at 2:19 a.m.
I was feeling lousy today, and I heard that the internet was running low on pictures of cats. So, here are some pictures of my cats.

Loss

Posted by Russell on February 03, 2010 at 11:48 p.m.

I normally don't talk a lot about my personal life on my blog, and except for the occasional announcement, I'd like to keep it that way. People's little triumphs and tragedies are mainly interesting to those directly involved, and are at best kind of boring to everyone else. A lot of my friends and family do read this blog, but by and large most of you are strangers or acquaintances. I try to respect that.

Those of you who are close to me know that I'm going through a sad time in my life right now. Those of you who work or study with me have probably noticed that I've not been my usual cheerful self. In deference to the many people who aren't here to read about that, and the fact that I can barely think about it (never mind write about it), I'm not going to discuss what's happened on my blog.

The one thing that has helped has been hearing about all the cool things that other people are doing. So, even though I'm not exactly Mr. Social right now, please don't take that as a sign that I want to be left alone.

On the contrary. Now would be a great time to tell me about whatever is on your mind, especially if it's cool.

To those of you who've been kind enough to treat me like a normal person over the last two weeks despite my melancholy behavior, I owe you guys. Really.

UC Davis, meet the internet.

Posted by Russell on January 12, 2010 at 1:42 a.m.
One of the wonderful things about web applications is that they can be available 24-7. They can sit there and quietly do their jobs -- taking orders, billing credit cards, assigning work orders, or whatever -- even when the office is empty. That's one of the main reasons one would go to the trouble of putting a web front end on something in the first place.

So, the question of the evening is, does the UC Davis registrar know this?

Um... no.

This is a completely automated process. If you do this during the daytime, it just goes ahead and populates a table in whatever chthonic legacy database system that is swaddled in this blob of early 1990's vintage web programming. It's not like having the office open at the time actually helps.

Attention Amazon.com shoppers! It's 4:45 Central Time, and Amazon.com will be closing for the day in 15 minutes! Please complete your order before the site is disconnected for the evening. We will open again tomorrow at 8:30 A.M. Thank you for shopping at Amazon.com!

On the upside, at least it doesn't complain that my browser isn't supported. Yay.

Central serous retinopathy

Posted by Russell on January 08, 2010 at 11:06 a.m.
The eye doctor in Davis confirmed that my magical eye bubble is central serous retinopathy. Here's a much better picture (now also on Wikimedia Commons).

That volcano-shaped thing is supposed to be a little pit (that's what "fovea" means).

I'm a bit pissed off that the Zeiss optical coherence tomography machine that the doctor used to take this image evidently keeps the data locked up in a proprietary format, and can only exchange data with other Zeiss products. The doctor says he can't even save a screenshot. The only way I could get this picture was by snapping a photo of the display with my phone.

I'm impressed with the technology, and I'm happy to pay for it. It's much better than the machine used to take the image in my first post about this, and allowed for a quick and unambiguous diagnosis. I just don't want to pay more for it than it actually costs. Ziess is taking a page out of Microsoft's playbook here by leveraging proprietary data formats and locked-down data sharing to coerce doctors into buying their equipment instead of someone else's. Except, the stakes are higher for medical products.

Update -- On February 9, 2011, I had Photodynamic therapy at the UC Davis Medical Center, under the care of Professor Susanna Park and her clinical staff. The surgery itself seems to have been completely successful -- the "bubble" is gone. However, because I had it for so long (more than a year), there was some damage to the retina, probably due to oxygen deprivation. This is taking longer to heal.

The result is that he distortion, blurriness and discoloration are gone, but dimness is taking much longer to go away.

I'm not a medical doctor, of course, but I suspect that waiting makes the recovery take longer. My hypothesis is that the longer the retina is under pressure and loosing part of its blood supply to leakage, the longer it will take to recover.

Usually, CSR will go away by itself, but if it doesn't, don't be complacent about it. Listen to your doctor about how long to wait, and then stop waiting.

Checking in on my contribution to Wikipedia

Posted by Russell on January 08, 2010 at 12:06 a.m.
Back in May 2007, I decided I'd try writing a Wikipedia article. I can't remember why I was seized by the impulse. I think I was supposed to be studying for something, and I'd already cleaned the bathroom and organized my closet. I pondered for a some time on the problem of selecting a topic obscure enough not to have a page already, and yet not so obscure as to become a target for the dreaded Deletionist clan of Wikipedians.

And lo, the Tasty Bite page was born. Looking at the page traffic, I fear that it will eventually become my most widely read piece of writing.

Well, they are pretty tasty. Oh, and those very mediocre pictures? I took those myself, and then consumed the contents of the pouch. Also, my friend Srijak says there is no such thing as "Bombay Potatoes," but he eats them too.

Not to sugar-coat things, but...

Posted by Russell on January 03, 2010 at 12:33 p.m.
Dr. Robert Lustig at UCSF gave a very interesting public lecture for UCTV on the relationship between sugar consumption and a host of health problems, ranging from obesity to diabetes to gout. I won't reiterate his argument, but the kernel is that he has bestowed the term "poison" on fructose. By "poison," he means poison in the same sense that alcohol is a poison. Fructose and ethanol are both chemicals that causes health problems, and that only the liver handle. Keep in mind that if the body were a city, the liver would be the part of town with the scary industrial stuff, all pipes and loud noises smokestacks and funny smells.

In the lecture, he suggests that fruit isn't necessarily bad, because fruit tends to come along with fiber, and fiber slows down the rate at which the sugar hits your blood. This gives your gut microflora a chance to get at it and metabolize it into less harmful compounds (though with the unfortunate but health-neutral side effect of flatulence).

Anyway, this got me wondering. Which sugars are in which fruit? Not all sugars, or fruits, are equal. So, here's a nice chart I made from some data I found somewhere on the internet.

I computed the ranking by generating a "badness" index as follows :

It makes me a little sad to see apples, pears and mangos down there at the bottom, though I'm delighted to see avocados at the top. Also, I would like to remind you that not everything that is quantitative is scientific, and making a nice chart of some data you find on a random web page is certainly not scientific.

In which I learned the importance of a stable telescope mount

Posted by Russell on December 30, 2009 at 9:17 a.m.
Over the summer, my dad decided to buy a nice little go-to scope for looking at the assorted planets and galaxies in our neighborhood. He wanted something relatively simple to operate so he could maximize the number of cool things seen in a given amount of time. He asked me if I could fine something with good optics and a usable go-to system -- the optics to keep him happy, and the go-to system for the assorted small children people keep bringing over and setting loose in his house.

Since I'd been playing with a couple of other Celestron products, I recommended either the Meade LT-6 or the Celestron NexStar 4SE. Honestly, I'd hoped that he would choose the LT-6, but since it costs about twice as much, he opted for the 4SE instead.

I'm out in Nantucket for new years, so I finally got a chance to try out the telescope this evening. The viewing conditions were not ideal (extremely windy and bitterly cold, and my right eye isn't still isn't back normal yet), but I think I can conclude that the telescope itself is pretty nice. I'm a little less impressed with the mount and the NexStar go-to system, though in fairness I haven't given them a fair shake yet.

And shake is indeed the watchword, I'm afraid. This was supposed to be Mars :

Admittedly, there was a bit of wind, but the telescope was planted firmly on a large stone pad and I used the time delay feature on my camera so that I wouldn't be touching anything when the shutter fired. This was only a 1 second exposure, so the shaking is pretty bad. I guess if you are hoping to do some astrophotography, don't bother with NexStar mounts. It feels good and strong, but it vibrates. Your eye can follow along just fine, but it sucks for taking pictures.

The telescope itself might actually be pretty good for basic astrophotography. Like a lot of Cassegrains, the 4SE has two optical ports with a mirror to switch between them. Celestron makes simple T-adapters for several models of SLR cameras, so you can bolt your camera body directly onto the second optical port. If you already have a DSLR, using it with the 4SE is very easy. Experimenting with 4SE and my Nikon D50 body seem fairly promising. Here is a shot I took looking through the window, which is laden with fingerprints, dog-nose-prints, and other assorted examples of encrustation and slobber :

Well, it's kind of easy, if you're comfortable using your DSLR in full manual mode. This is one area where I think the consumer telescope makers are missing a big opportunity. All DSLR camera bodies these days have some sort of interface for talking to the lens bolted onto its adapter ring. This allows for all sorts of nice features to work, like automatic light metering, autofocus, image stabilization, selecting F-stops, and so on. My Nikon D50 even has a little motorized driver to push the focus ring of autofocus lenses that don't have their own motors. There are lots of third-party companies that make lenses that work with various SLR bodies, so the interface standards must be obtainable. Why not make a smart T-adapter? A really basic, non-motorized autofocus lens for most DSLRs can be found for around a hundred bucks. I bet a lot of people would happily pay a hundred bucks for a T-adapter with a light meter and an autofocus driver. You'd have a point-and-shoot telescope, and all the brains to make the image capture work would be in the camera body. Which would be awesome.

I'm going to try again tomorrow night. I'm going to try keeping the tripod legs fully retracted, and hopefully there will be less wind.

Fun with mystery retinal bubbles

Posted by Russell on December 24, 2009 at 5:02 p.m.
About three days ago, I noticed a funny purple splotch in the middle of my right eye's visual field. It looked sort of like the splotch you'd get after seeing a camera flash, so I figured it would go away. Instead of going away, the next day it was bigger and darker. The day after, it was dark enough that I couldn't read with my right eye.

So, I decided it was time to put my health insurance to work -- which was pretty naive of me. Since I'm away from campus, I had to get a referral from an emergency room doctor (Anthem will only accept referrals from the UC Davis campus health center, or from an emergency room MD). Neither the cost of the emergency room visit nor the eye doctor was enough to exceed the deductible, so it all came out of my pocket (and Mimi's pocket). The deductible resets at the end of the year, which is in about a week. Lame.

Anyway, I was worried that it was some sort of retinal detachment, and was relieved to learn that it wasn't. Evidently, I have what amounts to a watter blister under my retina. Here it is :

Evidently, these things are usually stress-induced. Weird.

Also, I thought this was pretty neat. Here's my optic nerve :

Cool, huh?

Update : Well, the bubble got a lot bigger today, but space distortion started to go down. I think that means it's widening and flattening. I read up a bit about this kind of problem, and they are almost stereotypically associated with stress-addicts. I didn't think the last quarter was particularly stressful -- I rather enjoyed it. I've certainly had academic terms where I felt a lot more stress.

Usually, when I notice stress, it means that I'm feeling really unhappy about what I'm doing. The normal effect of that feeling is to make it harder to do whatever it is I'm doing, which I've always vaguely regarded as personal weakness. But if I can push myself hard enough to get blisters under my retina when I'm happily chugging along on my work, that makes my loss of productivity when I'm unhappy seem a lot more rational. I can almost imagine that it's a safety valve to prevent me from burning myself out -- at least on something that sucks.

So, I'm going to take this as a good thing. I've never been able to excel at classes I don't like, even when I found them to be very easy. No matter how motivated I was to "just get it done" (the advice of practically everyone in my life), something always sapped my energy. I'd pile on effort, and find that the effort required for the task seemed jump up just enough to absorb most of the extra effort I put in. But being unhappy and being under stress are not the same thing.

So, if I cheerfully worked myself into a stress-induced retinal blister, that's a pretty good indication that I've found something that bypasses my brain's "this sucks" filter. Now, I suppose I'll have to stop relying on my weirdly strong disgust with things that are boring to protect me from injuring myself. That's not a bad problem to have, actually.

Of course, all of this could be utter hogwash. I might have given myself a mystery eye bubble by reading all of John Scalzi's books in a week.

Kill the bill

Posted by Russell on December 18, 2009 at 2:50 p.m.
The calculus on the health care bill is very simple. If Democrats create a law that forces people to give their money to private insurance companies, and fails to create any sort of publicly administered alternative, the American people will hate it.

Conservatives and libertarians will hate it because it tramples on their freedom of choice and because it costs more than it ought to. Liberals and progressives will hate it because its a giveaway to companies that are widely agreed to be Evil Incarnate. Centrists will hate it because it won't work.

This isn't a "starting point" that can be refined as time goes on. It is a step in the wrong direction -- awarding even greater power and money to the already too-powerful insurance industry. It will give the industry the ability to raise premiums even higher and faster because people will legally have no choice but to pay them.

All major pieces of legislation evolve over time. They tend to do a better job of doing what they were designed to do in the first place. This was true for Social Security, Medicare, and many other social programs. It would be true for this healthcare bill too. The problem is that this healthcare bill doesn't do much of anything for citizens. It simply makes a gift of our freedom and livelihoods to the insurance industry, pure and simple. The bill will indeed evolve over time; the wussy regulations it creates to protect patients will get stripped out the instant the Republican party controls the government again.

I can swallow the idea of paying taxes to support a public service -- if the public service actually works. I cannot swallow the idea of being legally obligated to buy a product from a private party.

It's amazing. The Democrats in the Senate have actually managed to find an arrangement of circumstances that would actually be worse than the status quo. That's quite an accomplishment, given the breathtaking moral bankruptcy of our health insurance system.

Kill the bill. It will sink us.

Microscope shots

Posted by Russell on December 16, 2009 at 11:22 p.m.
My mom is doing some species survey work for the Navy, and got interested in these insanely tiny Chalcid wasps. Some of them are smaller than a grain of sand wingtip-to-wingtip, so it was pretty difficult to identify them under her binocular dissection microscope. I suggested maybe she should try out a consumer digital microscope before trying to get her grant coordinator to spring for anything huge and expensive. She picked up a Celestron microscope on sale from Amazon.

Obviously, it's not going to perform like one of the Nikon or Leica lab scopes, but it cost about one thirtieth as much, and it's humorously easy to use. If she can use it to zero in on the features used to identify these things and easily document what she sees, it'll do.

Here's what I was able to capture with a Chalcid wasp in ethanol with no slip cover. No effort was made to orient the objective, stain it, or improve the contrast. I just focused and hit the capture button.

Hmm... Looks like it might actually be usable with a little practice. The depth of field is not great, though.

I've been curious about the feasibility of making usable lab equipment as mass-produced consumer products. This scope is probably good enough for some specific problems, but not as a piece of generally usable lab equipment. But it's not as far away as I expected, actually.

A review: Sasha's Soup Club

Posted by Russell on December 06, 2009 at 11:05 p.m.
One of the cool things about living in Davis is the amazing number of unique creative enterprises and projects people open up to the public. I suppose Davis is a comfortable place for people to try things out.

If you live in Davis, you should try Sasha's Soup Club. After a few weeks of envying the tasty lunches my labmates were enjoying, I joined the mailing list. I just received my allotment Leek and Potato soup, delivered by Sasha herself.

What can I say? It's damn good soup, exactly as described. The flavor of the potatoes and leeks both stand out nicely. Whatever else is in it, the other flavors are there to make a nice background.

I get nervous about making things with so few flavors. When I aim to make a simple soup, it will usually end up with six or seven different ingredients with strong flavors. If one of them comes out a little weak, you can still enjoy the others.

My general approach to hobbies is massive over-engineering. This is why the computer desk I built for my mother is rated for 7200 pounds (I tested it by stacking dead tractor engine blocks on top of it). I know that I'll never make a living as a chef or as a furniture builder. But if I build something, goddamnit, it's not going to fall down. So, when I make soup, or a sandwich, or a salad, I keep adding ingredients that I'm sure will taste good until something in my head says, "Yup, it'll hold."

It's greatly reassuring to me that there are people who know how to make awesome things with simple economy. I know I can make potato leek soup myself; I made some just last week. It was good, but then again, anything would be good if you loaded it up with enough garlic, onions, cheese, olive oil, peppercorns and sea salt. I wouldn't have had the confidence to make this soup.

Now, the only problem is not eating it all before I have a chance to gloat over it at lunch.

First lab rotation

Posted by Russell on November 26, 2009 at 4:24 p.m.
Now that I have a free moment between chopping potatoes and mashing them, I figure I should post the paper and talk I wrote summarizing my first lab rotation.

I tried to make the paper look like an PNAS article, but alas, their LaTeX template leaves much to be desired. I like how the talk turned out little better, thanks the wonderful Beamer package for LaTeX.

Why is printing terrible?

Posted by Russell on November 26, 2009 at 3:53 p.m.
Mimi and I spent a good chunk of yesterday trying to print a three page PDF document. First, her dad's year-old HP OfficeJet 6300 stripped a gear in its paper feeder with no paper in the loading tray. It now seems to be beyond repair. So, we went over to her cousin's house, and a her HP all-in-one choked on a strangely formatted paper size directive. The error codes suggest that the printer's firmware got corrupted, but we couldn't get any more detail on account of Vista's printer stack simultaneously shitting itself, and remaining resolutely shat even after the usual Windows hokey-pokey of uninstalling/reinstalling, rebooting and banging the table and swearing.

We emailed the damn thing to her sister at her office, and she spent an hour futzing around with it before getting it to live uncomfortably on an 8.5"x11" sheet of paper, only to discover that someone had swiped the fuser wire from the big office laser printer. Six hours after we started, the three pages finally emerged from an old printer Lan found somewhere in a closet.

This seems to be the normal experience when you want to print an important document. Why is it still so awful? Why do people not riot in the streets and burn HP executives alive on pyres of new-but-broken plastic-crap printers? Why do people continue to allow PostScript to live?

Speaking of science

Posted by Russell on November 26, 2009 at 10:38 a.m.
One of the projects I've been working on this semester is designing a teaching unit for the UC Davis introductory biology curriculum. The introductory biology courses are required for a whole bunch of different majors at UC Davis, so all three of them are offered every quarter. It's a huge effort, and thousands of students take these classes every year. This is part of a teaching seminar led by Scott Dawson (don't bother Googling for him -- you'll find the wrong guy). The idea behind Scott's seminar is to take the half-dozen or so concepts that the BIS2A, 2B and 2C students struggle with, design teaching units aimed at those topics, and then try them out on volunteers. My topic is stochastic processes, which has been great fun. The project isn't finished yet, so I'll save the details for later.

One of the other issues we've been addressing in the seminar is how scientists relate to non-scientists. This is, for obvious reasons, an essential teaching skill. Even if they hope to be scientists someday, students are not scientists. If you don't find a way to talk with them about science, then you're wasting their money and their time.

The idea that the educator is largely responsible for the success (or failure) of the student hasn't really seeped into higher education, although it's been the standard thinking in primary and secondary education for decades. Not all elementary school teachers are good at what they do, but it is generally agreed that if they are good, the results will be seen in the subsequent success of their students. In higher education, things don't really work this way.

The most often cited reason for poor instruction at the college level is that many professors consider teaching secondary to their research. While this is clearly true in many cases, teaching in higher education doesn't just suffer from playing second fiddle to research. Many, many professors (even whole departments) who take teaching seriously are nevertheless not very good at it.

There are two causes, both of which are systemic problems. First of all, people who teach at the college level are usually not trained as teachers. Many (most?) professors have no education training whatsoever. Yet, even if you have natural skills, teaching isn't something you can do effectively without at least a little theory and training.

The result is that most of the teaching in colleges is done by amateurs and autodidacts. In contrast, at the primary and secondary level, teaching has been a job for trained professionals since the turn of the last century.

The second problem, which is partly a symptom of the first, is regular old-fashioned chauvinism. It is the responsibility of the student to learn, but many professors fail to see how they fit into this. This might be acceptable at a private, endowment-supported institution, but such places are exceptions. The Harvards and Oxfords of the world are free to treat their students however they like, but public institutions are ultimately responsible to the taxpayers. The taxpayers support such institutions for two reasons; to conduct research, and to educate their kids. Sink-or-swim pedagogy is a dereliction of duty.

This is a problem that extends far beyond the classroom. I was listening to NPR on the drive down to Los Angeles, and caught a story on All Things Considered about the reception of Darwin's On the Origin of Species. Some extracts :

"That fraction of people who figured that they could and should keep more or less up to date with what was happening in geology, in botany, in zoology, even in physics and mathematics is a much bigger fraction than it is today," says Steven Shapin, a Franklin L. Ford Professor of the History of Science at Harvard University.

...

"We hear about scientific findings," says Shapin. "But the proportion that can evaluate them and follow along with them, as opposed to hearing about them, is very, very small."

Shapin says that since people can't be completely conversant with the relevant science, "They're looking for an answer to the question, 'Who can we rely on? Who's speaking the truth? Who can we trust?' "

I think the good professor is missing the point. The problem is not simply that science has gotten more complicated and technical. It is true that there is more of it, and that it moves faster. The reason I don't buy Dr. Shapin's argument is that this is not at all unique to science. Everything moves faster and is more technical now than in 1859, and people seem to cope just fine.

The problem is that scientists do not spend enough time talking with the general public. Only a small minority of scientists take the trouble to arrange their findings in a form digestible by the lay audience, as Darwin did. When they do, it is almost never cutting-edge research that fills the pages. Very few scientists go on television or the radio. The practice today is to bring research to lay the audience only when it is neatly tied up (or, the research community feels that it is, anyway). There are those who do otherwise, but there is a negative stigma to it; scientists who announce their findings with press releases instead of peer-reviewed papers are usually regarded with suspicion.

Darwin's target audience for Origin -- the typical educated Briton in 1859 -- would not have much of an advantage on the average American in 2009. A Victorian gentleman would probably have had better handwriting and more patience for trudging through elliptical turns of phrase than an American high school graduate, but I don't think they would have much of advantage when it came to comprehending an unfamiliar scientific topic. The advantage Darwin's audience had was that it had Darwin.

When a good teacher notices that a student is failing to learn something, they will look first at their own teaching methodology for the problem. The same goes for scientists; when the general public doesn't understand or care about a scientific topic, a good scientist should look first at how they are publicizing their work. If the public doesn't think your research is important, then either you aren't explaining it well enough, or maybe it actually isn't very interesting.

Clones!

Posted by Russell on October 24, 2009 at 5:58 p.m.
Looks like I got my gene to grow in E. coli!

The colonies that didn't get the plasmid I'm using to carry MXAN7396 turn blue when grown with X-gal (bromo-chloro-indolyl-galactopyranoside). The ones that got the plasmid don't.

Neat!

Yays!

Posted by Russell on October 21, 2009 at 4:04 a.m.
I finally got through the double-PCR phase of the protocol without wrecking something. Yay!

My hacked up version of the gene gene is getting snipped up with everyone's favorite restriction enzymes (BamH1 and EcoR1). Then I get to splice it into a plasmid, and electroport the plasmids into some cells, and maybe they will do something interesing.

The cloning blues

Posted by Russell on October 19, 2009 at 8:43 p.m.
I've been doing my first laboratory rotation in Mitch Singer's lab, and trying to learn what people are actually doing when they publish these spiffy experimental results. So far, I've mostly been wrecking things. Fun disasters of the week :
  • Wrecked a DNA extraction by grabbing the wrong Pipetter and putting 300 microliters into a tube instead of 3.
  • Misread an illegible label and used butanol instead of ethanol, destroyed second attempt at the aforementioned DNA extraction.
  • Dropped the wrong tube in the trash, screwed up the third attempt at the aforementioned DNA extraction.
  • Kept a gel on the UV bench too long while trying to chop out little cubes with a razor blade, annihilated all the DNA, and screwed up fourth attempt at aforementioned DNA extraction.
  • The PCR cycler didn't close correctly, and my reaction tubes evaporated; screwing up fifth attempt at aforementioned DNA extraction. (At least this one wasn't my fault.)
I'm now spending the evening in the lab running everything over again, for the sixth time. Yays!

I definitely sticking to informatics -- that part of the rotation is going pretty well. I'm just not cut out for benchwork.

SmartMeter data from PG&E

Posted by Russell on October 05, 2009 at 1 a.m.
PG&E is no angel, but it deserves credit for making what looks like a good-faith effort to get California off of carbon. It's serious enough to have quit the US Chamber of Commerce to distance itself from the group's extremist views on climate change.

PG&E still owns six coal burning power plants, curiously located in Florida, New Jersey and Pennsylvania (presumably it uses them to swap power with other generators). It generates about 46% of its electricity from hydroelectric dams.


Rucker Creek dam, a small PG&E facility in Nevada County

One of the more interesting projects PG&E is undertaking is improving the resolution of its demand monitoring using SmartMeters. There is a lot of hype about the "Smart Grid," but basically it boils down to realtime use monitors, like these :

that are wired up to report the data somewhere. It's basically an off-the-shelf Tweet-A-Watt.

According to the PG&E web site, they are using SmartSynch meters, which use TCP/IP over some kind of wireless network. It's difficult to find information about the hardware itself, probably on account of the assorted idiots wetting their pants about people h4X0ring their refrigerators (actually, I don't know if Bill Mullins is an idiot, but his article about smart meters is depressingly typical).

Yes, it is possible for a bad person to break into your PG&E account to obtain this data.1 But so what? Power meters are inductively coupled to the circuit they measure. They can look, but they cannot touch. IOActive, a security research firm, claims that they can break into certain smart meters and "cut off power." I suppose we are meant to construe this as "cut off power to the house," but that isn't what power meters do. That is what those huge knife switches, with the lock-out-tag-out rings, are for. I'm skeptical that a certified electrician would work on a residential circuit with a computer controlled on-off switch. I certainly wouldn't. What "cut off power" probably means is that they can shut down the microcontroller, and stop the meter from collecting or reporting data. We're left to speculate, though, because the report is confidential. I speculate that they are hyping a buffer overflow exploit to gain as much attention as possible.

Nobody is going to h4x0r your refrigerator and reprogram it to be an E. coli chemostat. If you are worried about your personal data floating around on the big bad internets, your worries are better directed at your bank and your health insurance provider. The bad guys don't care that you left your bathroom light on all night last Thursday; they just want the routing number for your savings account.

While the data isn't very valuable for nefarious purposes, it is extremely valuable in the noble (if mundane) pursuit of frugality. Here's what PG&E shows you if you've been upgraded to a smart meter :

Having the graphs is neat, but the usability of the site is poor. Fortunately, they let you download the data as CSV files, although you have to go a week at a time. It's all very 1995. Happily, Google.org is working on a real-time data browser tool called Power Meter which will make this a lot nicer. For now, I just wish I had an XML-RPC interface.

I've already learned something from this data. On the 29th and 30th, I was at the Granlibakken conference center for the UC Davis Host Microbe Interaction conference. Those days show dramatically less power use between about 22:00 and 2:00, which is when I'm usually hacking at my desktop machine. One more reason to start thinking about replacing this behemoth.

1. Actually, it's stupidly easy to gain access to someone's PG&E account if you have their account number. Just create a new web account, type in the account number, and there you go! Now you can really fuck with them by paying their bill, which is about all you can do with a PG&E account.

Premises regrettably lacks belfry, cave

Posted by Russell on September 18, 2009 at 1:25 a.m.
I was going out to the garden to wash off the cat-litter-scooper this evening, and I noticed a tiny bat clinging to my screen door. It was hanging out about knee level, and I was worried my cats would take an interest in it. So, I tried to shoo it away, but it just chirped at me and clung onto the screen harder.

I thought maybe it was hurt (or worse, sick), so I captured it in a plastic bowl to observe. It didn't do anything to evade capture, and allowed itself to be sort of gently scooped up by the edge of the bowl. It walked around a little and chirped, but didn't do try to escape.

Since it didn't seem to be interested in flying around the apartment, I transferred it to the lid of the bowl, where it allowed itself to be photographed. I put a bead of water near its nose, which it prodded a little but didn't seem to drink.

I brought it outside again to see if I could get it to fly away. I held the lid out over a soft patch of ground and lowered it quickly, it spread its wings but didn't fly. I tried a few more times, and got it to fly as far as the fence. Finally, some tapping on the fence convinced it to flap away.

Does anyone know if this is normal behavior for this kind of bat?

Rooted phone

Posted by Russell on September 12, 2009 at 4:05 a.m.
I finally got fed up with the pathetic official Android release from T-Mobile, and rooted my G1 and installed the CyanogenMod firmware. Cyanogen feels about twice as responsive as Cupcake! It's like a whole new device.

Also, the tethering app is awesome. It turns your G1 into a WiFi base station and routes traffic from WiFi to 3G. Since I'm still waiting for broadband at my new apartment, it's a lifesaver.

I suppose tethering (and rooting the phone) technically violates T-Mobile's TOS, but I'm convinced that T-Mobile will allow both sooner or later. It's just too awsome, and it would help them sell more contracts.

It's kind of difficult to abuse tethering anyway; it sucks down the battery very quickly, and the latency is significant. It's the sort of thing you'd only use in a pinch. Those happen to be the situations where a little benevolence or selfishness from a big company can shape a customer's opinion forever. T-Mobile seems to be more sensitive to that kind of thing than the other networks. I know they've got their reasons for banning tethering apps, but I think they could be convinced to change their minds. (You can download various petitions from the Android Marketplace.)

Openness is where Google and T-Mobile could really go after the unwholesome, anticompetitive and un-American AT&T/iPhone alliance. The open nature of Android is a step in the right direction, but T-Mobile needs to get its legal department on the Open Access bandwagon if it wants to press the advantage.

After all, if some random people on the internet can roll better firmware for the G1 than their in-house developers, isn't it a strategic business advantage to let them?

The nocturnal velocity of cats

Posted by Russell on September 12, 2009 at 2:09 a.m.
I've been trying and failimg to get to sleep. The average interval of cat bombardment, and the mean momentum of the incident cat field has been unusually high. It took me a while to realize that this was related to the weather; it is lightly sprinkling. My cats have never seen rain.

That's a sobering thought in two ways. On one hand, they are old enough to have very well developed personalities, and yet are younger than the Obama administration by several months. On the other hand, it's been that long since it rained.

A busy month

Posted by Russell on September 09, 2009 at 8:06 p.m.
This summer has turned out a bit like a chocolate bar in the sun; everything started out nice and neat, but everything ended up squished into the bottom of the wrapper.

Right now, I'm working with Andrey Kislyuk on our little piece of the DARPA FunBio project. We're in the middle of a two-week code sprint, so I'll save that for a later post.

I also moved to a new apartment, and that didn't go nearly as smoothly as it could have. The guy we subleased from was in the process of buying a house, and the loan underwriter decided to yank back the money after he'd closed escrow (or was in escrow, or something). Evidently they wanted a sworn affidavit from the gardener that he was contracted to take care of the grounds. Anyway, the upshot was that instead of a nice leisurely move, he got stuck in the apartment for three weeks longer than he expected, and I was homeless for a week. Fortunately, one of the staff scientists in our lab was generous enough to let me stay at his apartment. Neil and Buzz got to learn about stairs, which they evidently adore.

Over Labor Day weekend, I went with Srijak and some of his friends from San Diego on a day hike at Lassen Volcanic National Park. I've always loved California, but it's nice to be reminded from time to time exactly why I love this place so much.

Because it's awesome.

And now, some astronomy

Posted by Russell on August 03, 2009 at 2:36 a.m.
For the last couple of weeks or so, Jupiter has been bright enough to cast a visible shadow on a moonless night. I'd been peering at it through the trees as I walk around town, thinking about buying a telescope. Then news came about the Black Smudge on Jupiter, discovered by amateur astronomer Anthony Wesley -- on a homebrew Newtonian -- and I thought, "That's it. I'm buying a telescope."

The problem is, I've never owned a telescope. When I was a kid, we had an ancient four inch refracting telescope, but it was missing some crucial parts, like the focusing drawtube, parts of the tripod, and one of the cast iron counterweights was broken in half (probably from coming unscrewed and dropping on the pavement). I played with it a lot, but for obvious reasons I never got to actually do any astronomy with it. When I lived in Ohio, I once used the Natural History Museum's incredible 500-mm Dall-Kirkham Cassegrainian to peer at Saturn.

Almost all of my telescope knowledge I owe to my college Optics course and its lab section, and the endless mind-numbing, poorly worded homework problems involving lenses and mirrors and pictures of carrots (I never found out why the objective was always a carrot). I could probably design a simple telescope on paper, but calculating a magnification factor and peering through a scope are very different experiences. I've been rummaging through telescope reviews on the internet for years, wondering how much I would really care about this or that optical aberration, or if I should spend more money to have less of it.

I decided to buy a really inexpensive telescope just to have a point of reference. This is what I've been playing with all weekend :

This is a Celestron FirstScope, purchased from Amazon.com for $43. Stephen R. Waldee wrote a ridiculously detailed review of this little thing.

When I was in eighth grade, everyone had to buy a Texas Instruments TI-82 graphing calculator. At the time, I had a computer (an elderly Macintosh SE loaned by a friend's mother, who had upgraded to a Quadra), but this was back when compilers were comically expensive. I could run programs, but I couldn't write them. The TI-82 wasn't as powerful as the Mac SE, but it did have a very well designed built-in BASIC interpreter and a fantastic library of functions. While my algebra teacher was tediously reviewing the previous day's homework, I tuned out and taught myself programming, Boolean algebra, functional formalism, iterative numerical methods, graphics, animation, and all sorts of other cool and useful things. Those stolen hours in eighth grade led directly to a degree in physics, four years working as a computational physicist, and graduate school in computational biology. The TI-82 was available, and it was extremely well-designed despite its limitations. In fact, I learned as much from what the TI-82 couldn't do as I learned what it could.

That's kind of what I have in mind for the FirstScope.

Anyway, I've been having a grand old time looking at Jupiter and the Galilean moons. Here's (more or less) what I've been seeing :

This is a 1 second exposure using a Takahashi TOA-150 that I rented for a few minutes using Global Rent-a-Scope. This guy beats the stuffing out of my telescope (the Takahashi is a $27,000 instrument!), but I'm really not using it for its intended purpose. What I see with the 4mm eyepiece on my telescope is essentially the same as what you see above.

I checked Stellarium to see which moons are which. From left to right, it's Callisto, Ganymede, Jupiter, Io, Europa, and the star HIP 107302.

Jupiter will occult HIP 107302 later today. This is kind of neat, since HIP 107302 is bright enough to see with the naked eye (at least when Jupiter isn't near it). If you Google for "Jupiter HIP 107302," you'll find that it's the brightest star Jupiter will occult for the next hundred years. Light from HIP 107302 will illuminate Jupiter's atmosphere from behind, and, I presume, yield some interesting data about its structure and composition for people suitably equipped to make such measurements.

Just for fun, and to be fair to the Global Rent-a-Scope people, here's another shot I took around midnight of Andromeda that really shows off the Takahashi's beautiful optics.

This is a 600 second exposure. I could probably do better if I fiddled with the exposure a bit, or did a color series instead of a single exposure, or knew anything about post-processing astrometric photography.

I've looked at M31 with my own little telescope, but all I see is a dot where the central core is. On the other hand, I was using the telescope sitting on the hood of a car in my apartment building parking lot under an obnoxious buzzing outdoor lamp. No night vision whatsoever. My verdict is that I've already gotten $43 worth of astronomy out of the FirstScope, and I haven't even used it under decent viewing conditions.

Summertime things

Posted by Russell on July 30, 2009 at 12:47 a.m.
Here are a couple of random cool things that aren't quite enough for a post on their own, so I'll stick them together.

It's been absurdly hot in Davis. Since the summer started, I've lost about nine days of productivity on account of my brain being too hot to function. By the time I get to the heavily air conditioned Genome Center building, I spend the rest of the day wanting to stick my head in a bucket of ice water.

Happily, the evenings tend to be very pleasant. And no, I'm not going to take Nate Silver up on his challenge. Good on you, Nate.

On Saturday, the Mondavi Center hosted Dengue Fever for a free concert on the quad. They are really great live! Chhom Nimol got all the little kids in the audience to come up on stage and dance. It was a great show.

My labmate Lizzy just adopted an adorable rescue puppy of unknown origin named Dweezil. He is very sweet, and already very well adapted to life with humans. He seems to love everybody, but Lizzy especially.

Meanwhile, my own rescue animals continue to puzzle me. Why does Buzz like to sleep behind my monitor? It's hot, and the cutter on the tape dispenser keeps poking him in the head and causing him to emit annoyed grumbling noises and squirm around. There are lots of comfy places he could sleep, but he likes this spot for some reason.

Android usability fail nuber two

Posted by Russell on July 28, 2009 at 6:42 p.m.
If you should happen to be filling out a longish web form (say, for example, a blog post) using the Android browser, and someone calls you, the browser will dump all your windows and obliterate the POSTDATA. Gee, thanks. That's exactly what I wanted.

Come on people.

What the hell?

Posted by Russell on July 25, 2009 at 5:17 a.m.
A guy in my apartment building just fell down the stairs right in front of my bedroom window. I put my glasses on and saw a puddle of blood slicking the concrete walkway, about ten feet from my pillow. About half the blood was coming out of his forehead, the other from a seep in his shirt where his collarbone is.

I went outside to see if he was moving. He wasn't. He didn't respond when I spoke to him. So, I did the logical thing -- I grabbed my phone and I called 911.

And it fucking crashed. So, I tried again, and it crashed again. I was in the process of ripping out the SIM card and charging up my old phone when the Davis 911 dipatcher called back. The good news is that the EMTs were fast. As soon as the dispatcher hung up, I stepped out to the street to wait for them, and I could already see the lights coming up the street.

So, listen here Google, T-Mobile and HTC: FUCK YOU. Fix your shit.

One year with solar

Posted by Russell on July 12, 2009 at 3:34 a.m.
A little more than a year ago, my mother installed 14 SunPower 230 watt panels on her roof. After a year of production, my mom's solar array has produced 5.3 megawatt-hours of electricity. That's about $1500 worth of electricity production.

Her actual use was about 3 mwh, yielding a surplus of about 2 mwh over the year. Rock on! Pasadena Water & Power won't actually write a check for the balance, but are carrying it forward indefinitely. Eventually, I suppose, they will figure out a way for her to cash in. I figure that someday she will be able to buy an electric car, and the extra production (plus the surplus stashed away in her utility bill) will go toward charging it.

Before installing the panels, she had whittled her electricity usage from about 32 kwh a day down to about 13. I thought it would be interesting to see the how things look now.

I decided to invert the Y-axis to represent net energy balance from the homeowner's point of view. Negative numbers represent net consumption, positive numbers are net production. The green region indicates the interval since the panels were installed. PWD bills on a bi-monthly basis, so unfortunately there are not very many data points.

The panels were installed in the middle of a billing period, so the first data point lifts away from the prior trend, and settles on a new trend. The third point in the green region -- the one that dips back into the negative -- is the middle of winter. Production was lowest, and my mom was running a space heater at her desk to keep her feet warm.

OMG snake.

Posted by Russell on July 04, 2009 at 2:22 p.m.
After it started to cool down yesterday, I went for a bike ride around the research farms, and I saw what I thought was a seam in the bike path. It wasn't until I was almost on top of it that I noticed that it was the shadow of a snake crossing the path! I ran over the poor guy before I could hit the breakes.

Fortunately, the snake survived, and went slithering into his hidey hole in the roots of one of the huge trees that line the bike path. I used a stick to touch the end of his tail to make sure his spine wasn't broken, and he reacted in about the way you would expect a not-run-over snake to react.

Sorry this isn't a very good picture. Since T-Mobile pushed out the Android Cupcake upgrade, my phone has been ridiculously, pathetically slow. It took almost a minute and a half to get the camera application open and snap a picture. By that time, the snake had spent 30 seconds slithering around on the bike path checking itself out (which would have been an awesome shot), and then gone about 20 feet into the grass. Boo Android! Fix your shit!

The snake was about four feet long and about the width of two fingers. The head was sort of bullet-shaped, as opposed to shovel-shaped, so it's probably not a viper. My guess is garter snake.

Cat tales

Posted by Russell on June 29, 2009 at 9:52 p.m.
In the last 24 hours, my cats have learned four things.
  1. Maximum face nuzzle! The larger (as yet unnamed) fellow really likes to nuzzle people. It's his thing. He climbs up on your chest, at pushes his hot dry nose into your face as hard as he can. A few days ago, he discovered that he can increase the nuzzling intensity by winding up a bit, like a pitcher throwing his own head. Yesterday evening, he discovered that he could increase the nuzzling intensity even more by getting a running start, and face-planting into my face while I'm reading.

    He is now starting from the hallway, and using the corner of my bed as a springboard to launch himself at my head at a full gallop. He tucks his paws under his belly and closes his eyes, so he comes in like a little furry nose-missile. I dare not get out of the way, or he'll hit the wall behind me and hurt himself. About half the time, I managed to catch him before he hits me.

    His little brother sits quietly on top of the pile of books next to my bed, and watches his larger brother do this with a sort of sad, disappointed expression on his face.

  2. Do not eat dental floss. They climbed up onto the sink, opened up the medicine cabinet, and pulled down my dental floss. They then managed to unravel the whole spool by chasing it around the legs of the kitchen table. Thusly restrained, they then proceeded to eat the dental floss, one cat at each end. I woke up to two very sad kittens, attached to each other by their pyloric valves, separated by about twelve inches of knotted dental floss. There was a lot of puke everywhere. I carefully pulled the floss out of their throats, which led to more vomiting. They hated it, but didn't struggle or scratch. They looked very surprised once they felt better.
  3. Stink beetles taste terrible. This hardly needs elaboration.
  4. Falling in the toilet is not fun. This evening, the larger fellow decided he was suddenly interested in the toilet bowl, which he's never cared about before. Perhaps this was part of a quest today to gain as many disgusting experiences as possible. He followed me into the bathroom while I was hanging up the towels from the laundry, and I could stop him, he scrambled up and over the seat and into the bowl head first. He seemed genuinely shocked to discover that he could not avoid the water at the bottom. Vigorous thrashing and yowling commenced. His little brother looked on from the threshold, looking grave and embarrassed (as usual). I pulled him out, and he stopped yowling, and stuck him into the shower, and he resumed yowling.

    Now he smells like Irish Spring, and keeps casting suspicious glances at the toilet. A few minutes ago he followed me into the bathroom again, and did his threat display (puffy tail, arched back, hissing, sideways-walking) at the toilet. His little brother, once again, observed from the threshold with a grave and embarrassed expression.

Cats! Help name them.

Posted by Russell on June 21, 2009 at 6:38 p.m.
I've adopted two kittens! They were captured with their mother in a feral cat colony out in the farmland somewhere around Davis. As much as I love cats, feral cats are a terrible ecological problem; they eat their way through the native bird population astonishingly quickly. The mother is supposed to be a champion huntress, which is kind of bad. She is too wild to become a house-cat, but fortunately not wild enough that she would have to be put down. Evidently she's been spayed, and will eventually gain employment as an official rodent control officer at a farm or vineyard, safely away from nesting areas.

However, I have a problem. I don't know what to name them! They have provisional names, but they're already growing out of them. They are brothers, so I'd like to name them accordingly. If you know any good names of brothers, or brothers-in-arms, from history or literature, please post below.

Candidate names are :

  • Buzz and Neil
  • Romulus and Remus
  • Castor and Pollux
  • Lio and Erasmus
  • Watson and Crick
  • Wilbur and Orville
  • Yuri and Glenn
I tried to think of some characters from Shakespeare, but most of the brothers in the plays murder each other, or do other dastardly deeds. Not very fitting for these two guys. They are just about the least mischievous kittens I've ever met. The worst they do to each other is to induce unwanted consciousness via squirming.

Bike safety column in print

Posted by Russell on June 19, 2009 at 4:55 p.m.
My article on bike safety is in print in the Davis Enterprise! I was invited to write this column as a follow up to my Davis Crash Map article and Anna's accident in 2007.

It's not up on their web site yet. I'll update with a link one they post it.

:: update ::

Here is the text of the article :

The Davis Enterprise: June 19, 2009
Davis Bicycles! column #20
Title: When road design gets personal Author: Russell Neches

Two years ago my little sister was riding her bicycle to a friend’s house. A woman was diving home from work. They met when the car hit Anna at 30 mph.

Before I go further, Anna is OK.

The weeks following the accident were hard. Aphasia, hematoma, and dental prosthesis became a regular part of family conversation. It was a month before we were sure she would get better.

Anna lives in Norman, Oklahoma. Norman is a lot like Davis; it’s roughly the same size, population and distance from the state capital. Norman hosts a big university and encourages bicycling.

After the accident, I desperately wanted someone to take responsibility. At first, I blamed Anna for not being more careful. Then I read the police report, and blamed the driver. But when I visited Norman and stood by the splashes of dried blood on the asphalt, I found I couldn’t blame either of them. The blame belonged to the road itself.

In sharp contrast to Davis, Norman has some of the sloppiest road design in America. The road where the accident happened has no curb, no sidewalk, no lane markings, no lights, and no center divider. The street is a smear of asphalt that informally fades into gravel and scrubby grass on its way to becoming front yard. This wasn’t some lonely country road. It happened downtown, right next to the University of Oklahoma. The equivalent spot in Davis might be about Seventh and E Streets. Until Anna’s face slammed into the windshield, the driver had no way of knowing for sure that she was driving on the wrong side of the road.

Davis does a pretty good job when it comes to road design. Even out amongst the farms, most of the roads have reflectorized lines to mark the center and shoulders. This isn’t because paint is cheaper in California. It’s because public officials have found that the lines help people be safer drivers.

With Anna’s final round of reconstructive surgery still in the works, I hope I can be forgiven for being preoccupied with bicycle safety. I’m a scientist. When scientists get worried, we go back to the data. Mapping the last couple of years of Davis accident reports indicates that the biggest problem spot in our town is the much-debated Fifth Street corridor.

It has been proposed to transform the stretch of Fifth Street north of downtown from a higher-speed four-lane road with frequent stops into a lower-speed two-lane road with center turn pockets. The design would look somewhat like B Street does now. I was surprised to learn that the two roads carry about the same amount of traffic.

Not everyone likes the idea, and some warn that slowing traffic may result in congestion. This must be taken seriously, and so detailed computer models have been constructed. The models show that the proposed design would actually increase throughput and reduce congestion somewhat.

This counterintuitive result is something with which I have personal experience. I grew up in Los Angeles, the poster city for congestion. It got that way because people tried to solve congestion problems by adding lanes. What we got for our billions of dollars was even worse congestion. LA has more acreage under roads than under destinations, and yet it is still asphyxiated.

Roads are ancient technology. Roman engineers would find California’s freeways impressive, but would learn little from them. But even ancient technology can be improved. We didn’t get from swinging stone axes to landing robots on Mars by refusing to try new things. Lane reduction has been tried in other cities, with great results for safety and efficiency.

The proposed Fifth Street design sounds like something worth trying. It will make Davis a safer, more efficient place walk, bike and drive. Repainting and installing different signals is part of the normal process of maintaining and improving roads. The proposal would simply guide this process. If it doesn’t work, the city has more paint. My family learned the hard way just how important lines of paint really are.

I’ve made an interactive map at vort.org/media/data/crashes.html displaying the last couple of years of Davis accident data. I hope it will inspire you think about how our roads are designed, how those designs succeed, and how they can be improved.

— Russell Neches is a microbiology graduate student at UC Davis. He has commuted to school and work through Los Angeles, New York and Boston on various vehicles including bikes, cars, trains, subways and on foot.

:: update 2 ::

Here is the direct link to the article on the Davis Enterprise website : http://www.davisenterprise.com/story.php?id=621.3

Marrow donor kit!

Posted by Russell on June 19, 2009 at 3:56 p.m.
I received my buccal swab kit from the National Marrow Donor Program. It took about three minutes to prepare. It's about as hard as brushing your teeth.

I especially like the biohazard sticker for sealing the sample card. Then, you just stick it in the mail.

They'll do the tissue typing, and (hopefully) add me to the database of marrow donors.

Seriously, why haven't you signed up yet?

Now blogging from Tehran

Posted by Russell on June 16, 2009 at 5:09 p.m.
Dear Iranian Security Forces:

Welcome to Vort.org, now from Tehran. Please spend as much time looking at this page as possible. There are lots and lots of links to follow. Who knows what important security information you will find? It is very important that you read every single post on this blog. Carefully. And discuss each of them with your superiors.

I may have scattered the names and locations of many active dissidents in old posts on my blog. Then again, maybe I haven't. You won't know until you look. Please take your time.

You can be from Tehran too:

<meta name="ICBM" content="35.696189, 51.422961">
<meta name="geo.position" content="35.696189, 51.422961">
<meta name="geo.placename" content="Tehran, Iran">
<meta name="geo.region" content="ir">

More things from Israel that annoy me

Posted by Russell on June 14, 2009 at 3:21 p.m.
If you can read Hebrew well enough to find the right contact form on their damn web site, please tell Bezeq that the following IP addresses are part of a botnet:

84.109.41.197
84.109.105.38
84.109.42.218
84.109.105.30
84.109.105.218
84.109.120.173

That is all.

What are you waiting for?

Posted by Russell on June 09, 2009 at 3:31 a.m.
Starting today, the first 46,000 who sign up can join the National Marrow Donor Program for free. Tissue typing normally costs about $50, so this is pretty neat.

I don't get along very well with needles, but this is kind of, you know, important. And it's fairly unlikely that any particular donor will be asked to donate. Tissue matches are very specific, which is why it's so important to get lots of people in the database.

If you are Asian, or any sort of nifty minority, then it's extra important that you sign up. If you are mixed race, then it's very important.

Mimi lost a friend to cancer this year because they couldn't find a marrow match. There could have been one more name called at her graduation if there'd been just a few more biracial hits in the marrow database last year.

Look at it this way. Superman saves people all the time, but he has to go through all sorts of bother and trouble with the secret identity and such. A few days of lower back pain seems like a pretty awesome deal in comparison.

If I'm ever asked to donate marrow, I'm getting a cape.

Another solar transit

Posted by Russell on June 03, 2009 at 6:01 p.m.
Now that she's all graduated and stuff, Mimi came out to Davis for my birthday this week. She took me to this place in Napa called, of all things, Ubuntu. Not only is it a nice word in Zulu, but it's also a Linux distribution, a restaurant and a yoga studio. Anyway, they were the runner up for best new restaurant of 2008 in the New York Times Food & Wine section.

It was delicious, but kind of difficult to describe. Evidently, the chef walks out into his garden each morning, peers at the ripening ingreedients, and invents the day's menu based on what's ready to eat. Neat!

Anyway, Mimi is here in Davis until Friday. We're having a great time biking around town and doing Davis-y things.

The tale of the rampaging lorry

Posted by Russell on May 23, 2009 at 4:33 p.m.
On Friday morning, a fellow named Boris and two of his friends got on their bicycles for a ride. As they pedaled along, observing the speed limit and traffic rules, a speeding truck overtook them. As it bounced over a speed bump, it's rear door swung open and snagged a parked car, and flung it across the road. It came within a few inches of crushing Boris and his friends.

So far, the event I've described above seems fairly unremarkable. Things like that happen all the time. There are two unusual things about this crash, though. First of all, the incident was caught on tape by a security camera, so we know exactly what happened. The three near-victims were Lord Adonis, Kulveer Ranger, and Boris Johnson; the UK's minister of transport, the director of transport of the city of London, and the mayor of London, respectively.


Helmet in hand, the mayor of London walks over for a better look at the car that almost killed him. This iPhone shot is by user Beatnic on Flickr under a Creative Commons license.

The three were cycling through London to scope out possible routes for a system of protected bicycle "super-highways." Mr. Johnson had the following to say about the incident:

"I am relieved that no-one was hurt, but this incident reinforces the need for us to make London's roads safer for cyclists, which I am determined to do and to make London the best city for cyclists in Europe.

"Cycle Super Highways, which are part of our record investment in cycling, will play a central role in this, providing clearly demarcated routes for cyclists that lorry drivers and others will be aware of."

What does this mean for American cities? I would take three lessons. First, London is huge, cramped, and damp. Yet London is looking to bicycles as a significant part of its transportation mix, and the city government takes it seriously enough that the mayor himself is regularly out surveying bicycle routes. Bicycles are a serious metropolitan transportation system, not just a recreational activity. Relative to London, cities like Davis are in a much stronger position when it comes to cycling; it should press its advantage.

Second, helmet laws and cycling safety initiatives are important, but even the most careful cyclist -- even the mayor of London -- can do very little to protect himself from a rampaging truck.

Third, out-of-control vehicles are depressingly common. If you want bicycles to play a serious role in municipal transportation, you must deal with vehicle safety.

As if vehicle safety weren't worth pursuing anyway! 43,000 Americans die every year in car accidents. That's like one 9/11 hijacking every month. Bringing this number down will take more than airbags and antilock breaks. It will require making some changes in the way we drive, and the roads we drive on.

The World Avoided

Posted by Russell on May 14, 2009 at 5:28 p.m.
NASA's Earth Observatory posted a fantastic article yesterday about a big computation effort led by Paul Newman, a scientist at the Goddard Space Flight Center. Newmans's group set out to answer the question, "What would have happened if we had failed to regulate CFC gases?"

CFC gases were essentially banned in 1989 through the Montreal Protocol, the world's first international environmental treaty of global scope. So, what did we avoid by banning CFCs?



Newman's group found that we avoided a previously unanticipated runaway cascade of ozone depletion, which would have led to a nearly complete loss of UV protection over the temperate and tropical regions -- not just over the poles.

The year is 2065. Nearly two-thirds of Earth’s ozone is gone—not just over the poles, but everywhere. The infamous ozone hole over Antarctica, first discovered in the 1980s, is a year-round fixture, with a twin over the North Pole. The ultraviolet (UV) radiation falling on mid-latitude cities like Washington, D.C., is strong enough to cause sunburn in just five minutes. DNA-mutating UV radiation is up more than 500 percent, with likely harmful effects on plants, animals, and human skin cancer rates.
By the end of the collapse, the UV index would have exceeded 30 in temperate North America. A UV index greater than 10 is considered extremely dangerous.

We're talking about radiation levels similar to Hiroshima in the days following the atomic bomb (though at a different spectrum), except across the whole planet, every single day, for centuries. A walk on the beach on a sunny afternoon would have been permanently disfiguring, and possibly lethal.

Instead of this hellish scenario, CFCs peaked around the year 2000, and they're already down about four percent. The simulations predict that the ozone layer should finish healing by about 2065. Sweet.

We saved the world, at least from that particular disaster. What did we sacrifice? Basically, nothing. We had to switch to different refrigerants, and it took a few years before people figured out how to make air conditioners that worked as well as the old ones. It might even have been a net positive for the economy, since it accelerated engineering innovation and equipment upgrades, and thus efficiency.

Carbon dioxide is going to be a bigger challenge. We emit a lot more carbon than CFCs, and the things we do that emit carbon are, for the most part, much more fundamental to our economy than running refrigerators and air conditioners. Nevertheless, the Montreal Protocol is a valuable lesson. It shows that politics can influence the world in positive ways, even when everything is a mess. 1989 was not exactly a banner year for political stability, good leadership, or economic strength.

Marathon!

Posted by Russell on May 09, 2009 at 11:21 a.m.
Mimi just called a few minutes ago to say she finished running her half-marathon! Neat!

Now she just needs to finish her thesis...

No alternatives

Posted by Russell on April 30, 2009 at 11:44 p.m.
The term "alternative energy" annoys me. It is a sloppy bit of wordsmithing. Do we really have an alternative to this?

No, actually. We don't. It's obvious, by simple inspection, that the scene above cannot continue. Even if we wanted to continue making electricity this way, it is impossible. Any activity this intensive and inefficient will run its course very quickly. It could happen in several ways, but the simplest and surest way it will stop is that they will simply run out of coal.

On one hand, we have a few reasonably non-destructive means of generating energy, like wind and solar. On the other hand, we have idiocy and crime. How is it alternative energy when there is essentially no choice?

As I've pointed out, coal is responsible for most of our carbon emissions, but provides less than a third of our generating capaicty. That is stupid. I suggest we dump the terms "green energy" and "alternative energy," and simply call those things energy, and use the term "dumb energy" to refer to coal.

Google for bioinformatics

Posted by Russell on April 30, 2009 at 12:53 p.m.
Interesting thing of the day : If you plug the following nucleotide sequence into Google :
"gctagttaaa aaaggaaatt catacccaaa"
The only hit you will find is the Swine Flu genome. Google is a sequence homology tool!

The Davis Crash Map

Posted by Russell on April 29, 2009 at 12:02 a.m.
I want announce a little project I put together over the weekend. For want of a better name, I'll call it the Davis Crash Map. Basically, I analyzed the accident report spreadsheets from the City of Davis Public Works Department, and made an overlay for Google Maps to visualize the data. The spreadsheets are a bit difficult to analyze, so I'm leaving out the reports that aren't clear to me (about 15% of the reports). The reports that gave me some trouble seem to be randomly distributed over the city, so the overlay should still give an unbiased picture of what is happening.

In particular, this is map is intended to examine bicycle accidents. I hope people will look at this map, and think about how they behave on the roads, weather on foot, on a bicycle, or in a car. How you behave on the road has direct, and sometimes dire, consequences for you and for other people.

However, there is more to this than behavior. This is also a design question. Roads are not natural features. They are designed and built by people for use by people. As with anything that is made by humans, there are good designs and bad designs. These designs have a real impact on peoples' lives. In the case of streets, the impact on your life can be very literal, as this map shows.

Even good designs can always be improved. Davis is a pretty safe town in which to walk, bicycle and drive. But if you study this map, and think about it as you go about the town, it's also clear that things could be better.

I'm not a traffic engineer, or a civil engineer, or a city planner. I claim no expertise in those areas. I'll leave it to other people to make specific suggestions. However, I think it is important for the users of streets -- pretty much everybody -- to think about what kind of streets they want. This map should help give you a better idea of what kind of streets we actually have.

For some reason, people seem to get very emotional about traffic. I grew up in Los Angeles, home of the nation's worst traffic jams. Perhaps this is to make up for our lack of a professional football franchise. Passions about transportation, especially mundane things like parking spaces and HOV lanes, get people really worked up. Los Angeles is also famous for road rage, and nowhere is it in greater evidence than in the corridors of City Hall. Public meetings on traffic can make I-405 look like afternoon tea. In fact, thousands of people from all over the world tune into the internet broadcast of the Santa Monica city council meetings to listen to Californians scream at each other over the exact position of little blobs of paint on little strips of asphalt.

What the conversation needs, I think, is some perspective. Data can help provide that perspective, especially if it can be represented in a way that is easy to understand. Maps are good at that.

If you will indulge me, I'd like to share my perspective on this data. Each marker represents a traumatic event for someone. Under some of those markers, a life came to a sudden, violent end. I'd like to share a picture of what kind of event a marker on this map represents. You won't find a marker for this event because it happened in Norman, Oklahoma, a college town that is a lot like Davis.


Anna and me

In October of 2007, my little sister was riding her bicycle near her house. A lady in a Mercedes made a lazy left turn, and crossed onto the wrong side of the road. She hit Anna head-on. Anna went up and over the hood of the car, and face-planted on the windshield, breaking her nose and her front teeth. The lady slammed on the breaks, and Anna then went flying off the car and slammed her head on the pavement. That much is clear from where my mother photographed the tire marks, the blood stains, and scattered teeth.


Who designed this street, anyway?

The sequence of events afterward are a little unclear, since Anna does not remember anything from that day, or for several days before and after the accident. The police report includes several details that are impossible or don't make any sense; for example, the officer thought she was coming out of a driveway onto the street, but the driveway did not belong to anyone she knew, and was paved in gravel (extremely annoying to bicycle on). The report also places the accident on the wrong side of the street, which was obvious enough based on the tire marks and blood. Based on what her friends say she was doing -- biking from her house to a friend's house -- she would have just been pedaling along the side of the road. The details of what happened are somewhat unclear, other than the evidence left on the road and gouged onto my sister's face.

After hitting the pavement, she evidently got up and staggered around for a bit, and then collapsed. She stopped breathing, and officer on the scene couldn't find a pulse, and assumed that she was dead. This was the reason given for not immediately summoning an ambulance.

Then she suddenly revived and started mumbling. The lady who ran her down went into screaming hysterics, and had to be restrained (or evacuated, or something). It was only then that an ambulance was called. From the report, it appears that paramedics and police spent a good deal of time tending to the driver of the car, who was having an anxiety attack, instead of Anna, who was bleeding from massive head trauma.

Anna then spent the next several days in the hospital. My mother got on the next flight to stay with her. For the next several days, Anna went through long and short memory lapses and dizzy spells of various lengths. When I spoke to her on the phone over the next several days, she also had some kind of aphasia, which was very jarring to me because she is normally a very articulate person. And then there was the puking. Brain injuries often come with a heavy dose of overpowering nausea. She was on anti-nausea drugs for a long time after the accident.

It took a long time for he to start feeling "normal" again. Almost two years later, she's still not sure she feels completely normal. Fortunately, thanks to some really great work by her surgeons, she looks normal. Needless to say, she is both very lucky and very tough.


Anna's bicycle. The police kept it as evidence, but allowed my mother to photograph it.

You could say that I have a personal stake in this, and I will not claim to be unbiased. Many people who argue against safety measures that would slow traffic argue their case on the basis of personal responsibility. We are each responsible for our actions, they argue, and if you do something stupid, you are responsible for the consequences. Why should people who don't do stupid things be inconvenienced?

I agree completely. However, if one casts any real issue into the frame of personal responsibility, then things are rarely so simple. Everyone who could act in a situation has responsibilities, even if they are not they are directly involved. When you have the power to prevent something bad from happening, and you choose not to act, then some of the responsibility falls on you. Every unfortunate, stupid thing that happens involves a cast of thousands of silent, but not blameless, bystanders.

We have a responsibility to at least attempt to protect people regardless of what they are doing -- even if it is stupid. This is especially true when it comes to the things we build. We shouldn't, if we can possibly avoid it, build things that injure and kill people. If we can think of ways to make something we build less dangerous, we ought to give it a try.


Anna and Earnie, about a year after the accident.

My little sister was stupid not to wear a helmet that day. The lady in the car was stupid not to have been on the lookout for cyclists. But neither of them deserved what happened. Each of them is obviously bears some measure of responsiblity (and I have my own opinions on how those measures are apportioned), but the city of Norman is also responsible. The city didn't even bother to paint a line down the middle of the road; what was the driver supposed to be on the wrong side of?

Yes, this is about personal responsibility. We, the public, build the roads. We are responsible for the markers on this map, and all the terror, trauma and tragedy they represent. Let's try to do better.

Bike saftey in Davis

Posted by Russell on April 25, 2009 at 11:18 p.m.
I've been tinkering with a little data visualization applet for looking at bicycle crash data in Davis, and I thought this map might be interesting to people. This is a image was generated with Google Maps and a heatmap overlay generated with a gheat tile server.

This is for 168 bicycle accidents that happened between 2004 and 2006. I have a lot more data, but 95% of the work in this little project involves parsing and renormalizing it. Evidently, police reports are not written with data processing in mind! I suppose that makes perfect sense. An officer at the scene of an accident probably has things on her mind besides generating a nice, easy to parse data point for future analysis. The priority seems to be completeness, rather than consistency. My parsing code, for example, has to be able to correctly detect and calculate distances measured in units of "feeet".

I'll release the applet here once I make an interface for it (and get the rest of the data imported). Stay tuned.

Awesome police report

Posted by Russell on April 24, 2009 at 3:23 a.m.
I'm not sure if I'm glad or sorry to have missed this conversation.

Fun with My Tracks, an accident, and Biking in Davis

Posted by Russell on April 21, 2009 at 5:40 a.m.
I was biking home today, and I decided to take a detour to enjoy the warm evening (and to avoid the not enjoyable warm apartment). About half way around the Davis Bike Loop, I remembered that I wanted to try out My Tracks. Here's the result :
Neat!

After wandering off the Bike Loop a bit, I decided to head home. I was biking down Russell Blvd., and I witnessed a very scary car accident. The accident happened where I stopped recording the track, at the red marker. A guy in a cherried-out lifted F-150 was sitting at the traffic light (that's the point where I turned around). When the light turned green, he floored it. According to the other witnesses, he was racing with someone, or trying to catch someone who had cut him off. I couldn't see the other car because it was behind his gigantic stupid truck.

What I did see, though, was that he accelerated continuously until he reached the next intersection (the red marker), where he had a head-on collision with a girl in a 1990's Honda Civic trying to make a left turn. His engine was deafeningly loud even a block away, and I heard it roaring and down-shifting right up until the crash.

Looking at the damage to her car, it looked like he basically ran it over. The lift kit on the truck put his undercarriage about level with her roof, and there were even little ladders installed to climb up to the doors. After he ran over the Civic, he swerved around a bit, jumped the median, sideswiped a small SUV in the oncoming traffic, spun 180 degrees, and snapped his axle. When the axle snapped, I heard his engine redline for half a second and then cut.

Happily, nobody was hurt. The girl in the Civic was pretty much petrified, though. She was convinced that the accident was her fault because she didn't get out of the way.

I told her this was nonsense; the truck was going more than double the speed limit, and I'm pretty sure he didn't have his lights on (it was dusk, but not completely dark yet). She asked me about five times, "How much do you think it will cost to fix?" I told her, "Cost you? Nothing. He was committing maybe a dozen moving violations, and probably racing someone. His insurance company will probably be so happy not to have to pay medical bills that they will buy you a whole new car."

Maybe she could have been a little swifter completing her turn, but it's a busy street and there is a lot of pedestrian and bicycle traffic (it parallels a bike path). Making a quick turn is probably not a good idea. Or, maybe she could have waited until this asshole passed, but, as I pointed out, he was going maybe 50 or 60 in a 30 zone, and accelerating. She timed her turn right for reasonable traffic flow, but didn't account for total maniacs among the oncoming traffic. It would have been difficult to judge when he would reach the intersection she was turning through.

Oi!

As it turns out, Davis has been thinking about redesigning this stretch of Russell Blvd. for several years. If you look at the proposed design, it would have made this accident impossible or unlikely. You can't race on a one lane road, and a landscaped medium would have prevented the second collision.

No love for X.org today

Posted by Russell on April 19, 2009 at 8:37 p.m.
I'd like to give a big fat raspberry to the X.org people today, and possibly the Debian X.org maintainers, for pushing busted X.org packages. Booo!

If you should happen to download said packages, you will find mouse and keyboard input on your computer completely disabled once the login manager comes up. If you log in via ssh (or boot with "single" in your kernel boot options), and look at /var/log/Xorg.0.log and observe the following,

(II) The server relies on HAL to provide the list of input devices.
	If no devices become available, reconfigure HAL or disable 
        AllowEmptyInput.
(WW) AllowEmptyInput is on, devices using drivers 'kbd', 'mouse' or
        'vmmouse' will be disabled.
(WW) Disabling Keyboard0
then you have contracted this particular affliction.

Dear X people, why the fuck would you make the default behavior to ignore properly configured devices? Especially when this can brick peoples' computers? Yes, I know about this. I stand by my raspberry. HAL still doesn't enable the right quirks for my motherboard, even though I submitted FDI files more than two years ago. HAL does not, and will not ever, work for everyone. When it works, it's nice, and I'm in favor of it. But please, please stop making life suck for people HAL doesn't help.

A pox on you all!

Anyway, the way you fix this particular bug is to add the line

Option "AllowEmptyInput" "false"
to the ServerLayout section of your xorg.conf file. For example
Section "ServerLayout"
    Identifier      "Default Layout"
    Screen          "Default Screen"
    InputDevice     "Generic Keyboard"
    InputDevice     "Configured Mouse"
    Option          "AllowEmptyInput"    "false"
EndSection
Props to K.Mandla for figuring it out.

HOWTO: Repair a broken Brompton chain tensioner

Posted by Russell on April 13, 2009 at 12:56 a.m.
A little while ago, I was riding home on my wonderful Brompton bicycle, and the chain tensioner suddenly disengaged. That had never happened before, and I discovered that the gear on the chain tensioner had completely smashed to bits. Here's what it looked like :

After puzzling about it for a while, I think I understand what happened. I use the same chain oil on my Brompton that I use on my racing bike. The "oil" is actually a mixture of a heavy lubricant in a volatile solvent. The solvent evaporates after coating the chain, and dissolves whatever gunk has accumulated. I think the solvent damaged the plastic. I've seen this happen with some plastics when they come into contact with gasoline. The gasoline dissolves the plasticizing agents, and leaves behind an open matrix of molecules, like a very, very fine sponge. The open matrix has a huge surface area and oxidizes rapidly. Your nice flexible plastic turns into something hard and crumbly, like a stale cookie.

That's what I think happened here. The remaining bits of plastic are still relatively flexible, but the bits that broke off have turned into a powdery mess.

The guy who sold me my bike offered to let me buy an idler wheel off of one of the bikes in his stock, but I didn't want another plastic gear. Here is what I built :

I bought a standard anodized aluminum derailleur gear from a local bike shop, and attached it to the Brompton chain tensioner arm with a few pennies worth of standard hardware. The new idler wheel (gear? cog?) slides along a little stainless steel tube I picked up at the hardware store and cut to length. This gives it enough play to allow for easy shifting. The tube has just the right tolerance to allow the gear to spin very easily, but not wobble.

Here's the exploded view :

From top to bottom, the parts are :

  • regular old bolt
  • two washers
  • stainless tube
  • gear
  • another washer
  • lock washer
  • nut
The gear is part of a Shift Biscuits pully set (though probably any pully set would work), and the steel tube is 7.94mm x 7.4mm (stock No. 7117) cut to length with a hacksaw (this took a while). The rest of the hardware is standard hardware store stuff.

I had to saw off the plastic axle tube on the chain tensioner arm because it would have prevented the idler wheel from sliding into the right position for the outer gear. I chose a bolt with a hex-head that fit snugly into the socket on the tensioner arm (similar to the bolts on the toggles for locking the frame in place). Once the nut is tightened against the lock washer, the axle is extremely rigid. The gear slips across the tube with almost zero play.

The shifting action is actually much smoother than it was with the plastic gear, and the bike seems to make a little less noise than I remember (that could be my imagination).

Yay! I've got my bike back, and without another dorky plastic gear, too. Neat!

Nice Nowruz!

Posted by Russell on March 20, 2009 at 3:48 a.m.
To my Iranian readers, happy new year! It seems president Obama is taking the opportunity to deliver a friendly message, too.

So, here's a link to the story on the BBC. Sorry, I couldn't resist. And sorry for the gratuitous alliteration.

Florence Alice Itkin 1920-2009

Posted by Russell on March 05, 2009 at 9:09 p.m.
Florence Itken, my great aunt, passed away yesterday. I was always very close with her growing up, and I lived with her for a year after I graduated from college. She was a great friend and teacher.

Flo was a teacher, in fact, from the time she was a little girl until the moment she slipped away yesterday. I thought I might share a few words about this great passion of hers.

Just as the Great Depression struck its most demoralizing chords, her father Solomon passed away, leaving the family to live off of my great grandmother's meager income as sweatshop worker. Like many first-generation Americans, Flo provided a lot of practical support for her mother, and helped her two sisters with their schoolwork. Flo was twelve, my grandmother Vivian was nine and my other aunt Selma was five. Florence spent her teenage years watching over her sisters's schoolwork and helping her mother.

Anna had missed the opportunity for formal education, and so my great grandmother was determined that her daughters would receive the best education possible. She had grown up in a rabbinical household in what is now Belarus, but she left for America (alone) as a young teenager. Later in life, she was an avid reader in English, Yiddish, Russian, and a bit of German and Hebrew. But until the Depression and the war were over, and her daughters safely making their way in life, all of that was on hold. Anna's hopes for her daughters' future depended on public education. Sight unseen, she placed those hopes on the University of California.

Whenever I think of their journey from New York to Los Angeles, I always think of Steinbeck's Grapes of Wrath, and imagine the surviving Itkens making their way among the bedraggled columns of Americans on the long road to California (though, I cannot imagine them tolerating any literal bedragglement). The fictional Joads fleeing the Dust Bowl for greener pastures of the California Central Valley, the actual Itkins fleeing the tenements of the Lower East Side for the sanctuary California classrooms. Fortunately, things turned out much better for the Itkins than the Joads.

All three of the Itkin girls went to UCLA, and all three of them became teachers. Florence became a colleague and friend of the great educator Corinne A. Seeds, for whom UCLA's Lab School is named. To give you an idea of the company Flo kept, you can read about Ms. Seeds (Flo always called her Ms. Seeds, even though they were close friends) in Pedagogies of Resistance: Women Educator Activists, 1880-1960, or if you're near Tufts, you can look up Professsor Kathleen Weiler, who is writing a biography of Ms. Seeds.

Barely out of college, Flo was one of the few people who publicly supported Ms. Seeds' opposition to the internment of Japanese Americans during World War II (for which both of them received death threats). Along with Ms. Seeds and others, my aunt was one of the shock troops of John Dewey's progressive movement. It is because of them that primary eduction is actually educational.

Flo was the principal of Kenter Canyon Elementary for, I think, about forty years. During her tenure at Kenter Canyon Elementary, it was the top-performing elementary school in the LA Unified School District. This was in no small part because Flo was an excellent teacher herself, and because she acted as a human firewall between her staff and "the conniving bureaucrats downtown," "the pencil pushers" and "the idiot school board." She retired on May 31st, 1980. Flo has teased me for my whole life on account of the fact that I caused my mother to miss her retirement party by arriving in the world on that particular day.

When I saw her on Saturday, she used what little energy she had to ask me three questions: How is school? When is Mimi graduating? Tell me what you've learned. Those were her last words to me, save three. To understand those three, I'll have to make a little diversion.

For Flo, politics was an integral part of being a teacher. She believed that a good teacher should fight for her students, and should not be shy about carrying the fight wherever it had to go. The task of an educator is to create opportunities for her students. That means that an educator is called upon to confront prejudice and ignorance when they threaten those opportunities. Flo believed that smashing social barriers was just as important as multiplication tables (although, this was not a simple distinction to her, since one can smash social barriers by teaching multiplication tables, depending on who was doing the teaching and who was doing the learning).

Of course, she didn't clutter up her classroom with politics. Education is a science, and she was a serious practitioner. Her politics was about clearing the road ahead of her students.

It came as a huge shock to me that her views were so forceful. She was the very model of an elementary school principal -- proper, patient, and professional. She was the sort of lady that hippies feared; she would have told them to wash up, given them The Look and used The Voice, and made them feel very foolish.

Flo kept her radicalism under tight control, unleashing it in calculated measures. The people who saw her act on those principles never knew what hit them. She only brought out the knives in board meetings and budget committees. Most of the time I knew her, she seemed like a funny, sweet old lady. But when Her Children (or students generally) were threatened, the sweet old lady was suddenly made of steel. She would, and did, go to war for her pupils and for her teaching staff. I suspect that her first objection to Japanese internment was that it took students out of their classrooms, and death threats weren't going to stop her from raising hell about it.

I was with Flo through the 2004 election, and she was devastated. George Bush was, in her view, a teacher's worst nightmare. He was a great propagator of ignorance, advocate of prejudice, a spoiled, dull child of a rich politician, and a conniving bureaucrat. Flo described the mandatory testing in the No Child Left Behind Act as "a bunch of skull-measuring" and "a jobs program for bad administrators."

A few days after Kerry lost, I was having breakfast with Flo and talking about the election. Flo waived at the double fistfull of pills she was trying to swallow and said, "Damn him, now I'm going to have to do this for another four years." Like all of Flo's Pronouncements, it was accomplished. She weathered four years of Parkinson's disease, heart failure, blindness, broken bones and (most painfully) the dismal news of the last four years so that she could deliver her vote for the sake of her students.

I asked her what she thinks of our new president. She gasped, and gave me the thumbs up. "I'm so proud," she said, speaking, I know, as a teacher.

Florence loved flowers, but if you really want to honor her memory, please do so by supporting teachers.

Why I don't care about 802.11n

Posted by Russell on March 03, 2009 at 5:17 p.m.
I wish the WiFi Alliance people would stop worrying about the maximum speed of the 802.11 family of protocols, and instead worry about improving cooperation among networks. When 802.11b was new and shiny, it was fairly unlikely that you'd have to worry about spectrum competition. Now, wherever you are likely to find one network, you are likely to find a dozen.

Usually, this kind of mess happens in residential areas, but I've seen it lab buildings also. I would be more than happy to route a few of my neighbor's packets on my network in exchange for less spectrum congestion. What is needed here is a protocol that would allow owners of clashing access points to decide who they are friends with.

Of course, this would mean that anyone who owned an access point would have to be able to assert common carrier status, which could have some interesting side effects.

An un-shout-out

Posted by Russell on February 23, 2009 at 11:45 a.m.
As a Jew (or as some people might insist, someone of Jewish ancestry) and as an American, I'd like go on record and say that Avigdor Lieberman is a fucking piece of shit. So is his party, so his his loyalty oath, and so is everything he stands for. And I'd like to extend a big fat "Fuck You" to everyone who voted for him, and to everyone who signs his loyalty oath, and to every fellow traveler throughout history.

If you don't know who he is, imagine crossbreeding Ann Coulter, George Wallace, Sarah Palin and Joseph McCarthy, and then Bar Mitzvah the result.

First ceramics!

Posted by Russell on February 13, 2009 at 7:27 p.m.
I just got my first pieces back from glaze firing today! They turned out much better than I expected, though, honestly, I wasn't expecting much.

This is a smallish cereal bowl (about eight inches in diameter). It is, thus far, the most symmetrical piece I've made, and I'm really happy with it.

This was the first piece I threw. I haven't thrown clay since I was about eight years old, so this is the first in about twenty years! I was pleasantly surprised to find that it's actually reasonably usable and not altogether hideous.

That country in the middle

Posted by Russell on February 07, 2009 at 9:38 p.m.
After convincing Kyrgyzstan to evict us from our air base at Manas, Russia is evidently offering us transit rights to resupply our troops in Afghanistan. As I was looking at the map in the Sacramento Bee, I was reminded of what a logistical nightmare our operations in Afghanistan are. There is a reason the region has such a violet history; it has the most unfavorable political and geographical cartography on the planet.

And guess who is smack in the middle of it?

I made the map above as a friendly and non-scientific reminder about why diplomacy with Iran is so important to American interests. The outcome might not be a friendly Iran, but it would be really great if we could, you know, fly over it without getting shot at.

Kodo on tour!

Posted by Russell on February 06, 2009 at 7:40 p.m.
I went to see Kodo at the Mondavi center this Wednesday. I've been listening to Kodo since Mondo Head came out in 2001, and they just keep getting more awesome. I especially enjoyed Yoshie Sunahata's solo, which I'd not heard before.

I cannot stress this enough: Go see this show if you can.

In which I confess that I am amused by odd things

Posted by Russell on February 01, 2009 at 3:50 a.m.
I was reading Planet Gnome, and followed Pascal Terjan's post to the PyPy project, and decided to play around with it. I've been studying for midterms all day, and this looked like a mildly educational way of goofing off for half an hour.

After the initial amusement running some of my python code in a python interpreter written in python and running in another python interpreter, it occured to me that there is absolutely no way I could articulate why I think this is cool to someone who didn't already think it was cool.

Yet it is, nevertheless, kind of awesome.

The Road Ahead

Posted by Russell on January 19, 2009 at 7:59 p.m.
Today is that last day of George Bush's presidency. I have waited eight years to write those words, and oh how sweet they are!

A good friend of mine remarked recently that while he liked reading my blog, it was depressing him. So I went back over the archives, and I realized that a lot of it has been pretty depressing. But then again, it's been a pretty depressing time for America, and I think a lot about national issues. There have also been some rough patches in my own life; my advisor at UCLA closed down his group and moved to the UK, and I had to figure out what to do with myself. That has colored my writing.

Tomorrow, two things are happening that believe will administer a stiff dose of optimism around here. First, America will be under new management. Second, I am scrapping my plans to work in physics, and joining Jonathan Eisen's lab. These are not wholly unrelated events, and so I decided to address them together.

First up, the big picture stuff.

On the evening of November 7th, 2000, I discovered rather to my surprise that I do, in fact, love my country. My recollection of the evening and the time that followed has an amusing resemblance to a romantic comedy; I played the insensitive jerk who doesn't appreciate his wonderful girlfriend until she is suddenly gone. Let's say, for the sake of argument, that she is carried away by baboons. Or perhaps Richard Gere. Or maybe Richard Gere playing a baboon.

Then, for the first excruciating half of the movie, I slowly begin to understand how much I needed her. I discover, to the merriment of all, that I cannot cook, that I don't understand money, and so on. The movie trailer features a memorable scene in which I am eating molding Chinese takeout in my underpants as my life comes crashing down around me.

Then, and epiphany! I should win back the girl from the baboons, or Richard Gere, or whatever. Some amusing side characters are introduced who help me on my hilarious and humiliating quest of self-discovery and girl-retrieving.

That's kind of how it went. Instantly, as soon as the results started to come in, I felt an icy lump in my stomach. When it became clear that George Bush was going to win, I started to recognize the feeling. It was familiar. The last time I had experienced it, I was a fifteen-year-old at the bottom of a drainage ditch, looking at how my right hand was twisted around backwards and resting backwards against my forearm, the radius snapped and the ulna cracked lengthwise and telescoped into itself.

The most lucid memory I have about breaking my arm was that it did not hurt. The pain came much later, after everything was nicely set and wrapped up, and the doctors had explained that it would heal nicely. But at the bottom of the drainage ditch, there was this very singular feeling. Not fear, or pain, or surprise, but cold, icy dread, like the firmware of my brain had suddenly broadcast the message, CRITICAL ERROR! and terminated everything else in my head. Emotions, ideas, thoughts, memories, all were gone. There was nothing but a paralyzing tsunami of Wrong! Wrong! Wrong!

That's what I felt on November 8th, 2000. Something terrible had happened. I had lost something really, really important, but I was too dumb to understand what it was. My country, which I had loved all along but never appreciated, had been carried away by baboons.

As the months and years unfolded, I got to know what I had lost from the shape of the hole it left. I discovered the first ragged edge of that hole during the Hainan Island incident. America suddenly seemed bumbling and weak, thundering with indignation and then groveling pathetically. The State Department evidently couldn't even be bothered to write the official letter of condolence for Wang Wei's death in Chinese, and so the CCP naturally translated it to sound like an admission of guilt. The Bush presidency was pretty much downhill from there.

But this is a romantic comedy, after all. I spent the summer of 2006 in Oxford, mostly apologizing for the idiot in the White House to all the nice people I met from the rest of the planet. I came home determined to get my country back. So I started researching candidates for the midterm elections. There were some really great people running, and so I sent in my tiny little donations over the internet. I signed petitions, sent grumpy letters to newspapers and did a little phone banking. Six months later, a nice lady from San Francisco became the first woman to wield the Speaker's gavel.

So, you get the idea. Struggles, setbacks, successes; lots of painful, cringe-worthy scenes that screenplay authors think are funny. I've got my country back, and I've learned my lesson. I'm never going to take her for granted again. Today, the credits roll. The movie is over.

The prognosis for the next couple of years is dismal. The economy sucks, our financial system has utterly collapsed. Wall Street is a financial Chernobyl; we've gone through the blackout, the meltdown, a series of ruinous detonations as various subsystems superheat and explode, and we are now watching it belch radioactive smoke into the Jet Stream as the whole thing slowly burns. We are also hurtling towards a point-of-no-return in the great phase diagram of atmospheric carbon. Oh, and we're fighting two wars.

Nevertheless, I'm pretty happy. Our problems have solutions. We've just elected a guy who has a very clear view of this colossal mess we're in, and doesn't flinch.

Now, I'll take a step down in scale a bit, and talk about why I'm leaving physics.

I decided to study physics for a very simple reason; our planet's atmosphere is filling up with carbon, and if we don't stop digging shit out of the ground and lighting it on fire, we're going to wreck the place. Like most people, I figured that we need a big source of energy that doesn't involve burning black stuff from the ground.

But the more I learned about the energy economy, the more I came to understand how wrong I was. Yes, we use a lot of energy. Most of it is from burning black shit we dig out of the ground. But for the most part, we fritter it away. We spend gigawatts lighting empty rooms, running idle computers and refrigerating nonperishable food. We blow a big fraction of our electricity into the night sky, benefiting no one, except perhaps future generations of alien astronomers. We blow billions of gallons of fuel driving to places we don't want to go, flying to places we don't want to see, and moving products we don't enjoy.

In the very near future, we're going to have less fuel and less electricity. And you know what? It's going to be fine. Little by little, prices will go up, and the waste will go away. In retrospect, we will see that most of the energy we use today was utterly and completely wasted. We will learn to waste less of it, and everything will be fine. People will wonder what the big deal was.

There will be some fancy technologies, like solar panels and wind turbines. I learned a bit about that by designing a solar array for my mother's house this summer. It generates more than she uses, cost about as much as a small car, and took three days to install. It will pay for itself in about sixteen years, or maybe sooner if rates keep climbing, and it will last for about 40 years. It was almost disappointing how straight-forward it was (though it was a lot of fun). Cutting her energy use from almost 40 kilowatt hours a day to less than 10 was totally painless. When it's time to replace the washing machine and the refrigerator, her house will draw less than 7 kilowatt-hours a day. The panels generate about 13 to 17 kilowatt hours a day; her last electric bill was negative $102.

In a nutshell, here is the solution to the energy crisis : Stop being a pussy.

We don't need to be "saved" from this. Not by fusion reactors. Not by advanced nuclear whatever. Not by magical carbon sequestration. The human race will have fewer gigawatts to play around with, and so we'll use them more carefully. The reality of the energy crisis is this: Our sense of entitlement and its associated low inclination to innovate is coming face to face with the laws of physics. Physics will win. Exit crisis, pursued by a bear.

Energy is neither cheap nor abundant. It never has been, and it never will be. If you don't believe me, get on a stationary bike and do 860 calories of work (you'll burn about 2400 calories, or three good meals). That's one kilowatt-hour. You will be tired as hell. Right now, you pay about a dime for that much work. No matter how you generate it, it's crazy to pay so little for so much. It should come as no surprise that there are hidden fees in the fine print, like "may destroy the Earth." Cheap energy was always a Faustian pact.

There are lots of good reasons to build reactor tokamaks, but cheap energy isn't one of them. Fusion would be a great power source for space exploration; the fuel is everywhere, you don't have to worry as much about radiation, and you get your vacuum pumping for free. Sometime soon, I think we'll do just that. But for now, I simply refuse to grind through all that horrible mathematics just so Cody McFuckhead can leave his X-Box running while he goes on spring break.

This is actually a delightful discovery. As long as I was getting my understanding of the energy situation from media sources, it looked very very grim. Things look totally different once you become conversant in the ways we make, transport and use energy. Climate change is a real crisis and a real problem, but the solution is anything but rocket science : Bulldoze all coal-fired power plants, and forbid the construction of new ones. Do it on a nice predictable schedule, and let utility prices rise just at a pace that allows people to keep up with the adjustments they have to make. Provide targeted aid where it's needed, like weatherizing and insulating houses for low income families. Space it out over ten years, and start with the utility markets that can adjust the fastest.

Bulldozing our coal fired plants would cut America's carbon emissions in half, an only sacrifice about 27% of our generating capacity. If organized carefully, utility prices would rise to less than $0.40 a kilowatt hour, and then fall to near previous levels as conservation measures come on line. Why is that so scary? We don't suffer from a lack of alternative energy, we suffer from a lack of balls.

I thought about this a lot over the summer. Obama's victory finally gave me the clear concience to change direction. The newspwpers are filled with hand-wringing about the budget deficit, but I'm more concerned about America's chutzpah deficit. Obama might not be able to fix the budget anytime soon, but he's already recapitalizing our country with a desperately needed infusion of guts.

I was always interested in the computational side of physics, and so a shift to computational biology is not as big a shift as I'd feared, especially since I am only just starting. It's a different world, and I'm already starting to feel that it's a better fit for me.

Energy has always fascinated me. "Follow the money" was Mark Felt's advise to Bob Woodward during Watergate. If you want to understand politics, economics and history, money is the skeleton that gives shape to events. The currency of the universe is energy. It is the specie of all things from galaxies to microbes. If you want to understand the physical world, you follow the energy.

The energy balance sheets seem to contradict the idea that we have a crisis of power generation. Quite the contrary; they indicate a massive glut. That in itself raises other questions. For example, how has this glut of cheap energy distorted our economy? How will the end of this glut change our economy?

I'm not an economist, and I don't want to be one. In any event, following the energy leads to other more interesting questions. How has the flow of energy shaped us? A photon strays into the waiting chloroplast, ultimately making a sugar molecule. The molecule becomes part of the meal of a gazelle. The gazelle and a hunter sprint together through a blazing sunset over the Rift Valley a hundred millennia ago. We owe our existence to a wrinkle in the ledger books of the planetary energy accountancy. How does that work?

Things are looking up.

Warm spell

Posted by Russell on January 13, 2009 at 8:52 p.m.
I was biking to the gym yesterday, and it occured to me that since it was so beautiful outside, I may as well just keep biking. So, instead of sitting on the stationary bike, I did a three and a half hour ride down some random county road. It was awesome, even with my funny little commuter bike.

Along the way I passed this pathway planted with olive trees through the middle of one of the UC Davis research farms.

Note to self: Plant more olive trees.

Second quarter at Davis

Posted by Russell on January 09, 2009 at 2:41 a.m.
This quarter, I'm taking :
  • Mathematical Methods : Laplace transforms, Fourier transforms, Greens functions, and their applications to partial differential equations.
  • Quantum Mechanics: Again. For the heck of it.
  • Numerical Methods: Analysis of the performance, stability and error propagation of numerical algorithms in finite precision systems.
So far, it's way more fun than last quarter. Still, I'm disappointed that the molecular structures course I wanted to take conflicts with numerical methods. Hopefully I can take it next quarter.

The preliminary exam for mathematical methods is in the middle of finals week at the end of this quarter. That is going to suck.

Travel notes (part 2)

Posted by Russell on December 30, 2008 at 7:48 p.m.
As I mentioned in the previous post, I saw an awful lot of houses. Some of them made me a little jealous, and others made my skin crawl. All of them got me thinking about the housing crisis.

While the housing bubble was in full swing, I had a very strong intuitive reaction to house prices; everywhere I looked, I saw prices that felt two to ten times too high. As it turns out, my intuition was right. Houses that were worth something were vastly overvalued, and there were an awful lot of houses that simply should not have been built at all. The latter was usually due to a combination of uninspired design, remote location, and natural hazards. Again, it turned out that I was right. (I don't claim exclusive clairvoyance here. Lots of people felt the same way.)

There are many things that helped create this situation. The answer the idiot-media has been pushing is that subprime loans flooded the market with money by giving loans to people who didn't qualify. The flood of cash drove up prices, which are now coming down. Leverage is definitely part of the problem, but the subprime aspect is overblown and widely misunderstood.

The fundamental problem is that there simply isn't enough affordable housing. People need homes, and there are good financial reasons why people want to own their homes. If home prices are out of reach, then of course people will abuse leverage whenever it is available. The market simply isn't supplying enough affordable housing.

Why not? The simple answer is the conflict of geography and geometry.

There are two categories of factors that contribute to the value of a home; the home itself, and the resources that can be tapped from the home. The resources available from the house provide options to the homeowner; more options mean better quality of life. More options also mean that a particular house could satisfy the needs of a greater number of potential owners, giving it more resale value. History has proved again and again that the second category is vastly more important than the first. Hence the expression, "location, location, location." This is why airless, vermin-infested closet space in Manhattan sells for millions of dollars while palatial estates in Riverside can be had for less than a tenth as much. It goes without saying that the owner of the airless Manhattan flat has access to more resources, and resources of higher quality, than the owner of the ranch in Riverside. That is the geographical aspect of the problem.

The geometry aspect comes into play when you consider how structures are distributed and how resources are made available in these structures. The Earth provides an approximately two-dimensional plane (actually, modern economic and military history can be viewed as a consequence of the increasing importance of the Earth's spherical geometry, but right now I'm thinking of more local effects -- read, for example, the chapter "Global Midway" in War and Remembrance to get a sense of what I mean). Resources available from a particular location scale like the square of the density of resources within the distance accessible from that point. As the density increases, people will start building upwards (sky scrapers) and downwards (excavation). This introduces a volumetric effect, causing the available options to scale like the cube of the local density of resources. As density continues to increase, it becomes financially viable to build mass transit, which extends the radius of practically available options. This introduces a quartic scaling. As the density increases further, it becomes necessary to seek synergies and greater efficiency to minimize use of space. This introduces a scaling at the fifth power of density.

So, as the density of a settlement increases, geometry militates the use of ever more potent means to reduce the footprint of an available resource, which in turn facilitates greater density. Each new means of increasing density adds an additional linear scaling, so that the ultimate scaling is approximately

Of course, a polynomial of infinite order is the Taylor expansion of the exponential function. So, we can claim that the approximate value of a home scales exponentially with the density of resources in that area. The first three terms are required by simple geometry, and higher terms increasingly represent technological and social responses.

Really, this is the lower bound on the value; the value of a home also depends on how many other people might want it. If people select a home mostly for the choices it makes available to them, and each person has a different collection of choices they want, then there is some kind of combinatorial scaling as well (I'll leave this one as an exercise; you can get several different scalings depending on the assumptions you make).

Meanwhile, the value of the house itself scales linearly with the cost of the stuff you put into building it (labor and materials). However, nicer houses tend to be larger, and thus neighborhoods of big houses tend to be sparse. Thus, if the value of a home is the sum of the value of its location and its embodied value, embodied value will inevitably be overwhelmed by the locational value. This is a classical Malthusian conflict, but in this case the functions represent different things.

So, why the crisis? Well, we have artificially capped the growth of density. Zoning laws forbid the construction of new Manhattans, and require the gradual erosion of existing high-density neighborhoods as their buildings wear out and need to be renovated or replaced.

This is the story we tell each other about how this happened; the automobile gave people greater mobility, allowing them to live in the suburbs and countryside while they still work in the city. So, there was a great exodus from city centers to suburbia. This narrative has things exactly backwards. Density at the city periphery was legally capped and aggressively driven down, which forced people into the suburbs to seek affordable houses, making automobiles necessary to access resources that were previously available on foot. The first story is a marketing pitch, the second is recorded history.

In the early post-war period, opinion surveys consistently showed that the top transportation issue on the minds of Americans was the improvement of streetcar service, and the top housing issue was the rapid inflation of rent and other prices in city centers after the wartime price controls were lifted. People did not particularly want cars and suburban bungalows; they simply made a rational choice in the face of exploding rent and decaying public transportation. Even so, suburbia remained relatively unattractive for most people until Brown vs. Board of Education in 1954, and picked up steam in the early 1960s when racial tensions transformed the suburban exodus from an economic issue into a racial one. See, for example, the abandonment of Detroit, or white flight from Los Angeles to Orange County. That is the story of suburbia.

There is one more geometric factor to consider regarding the value of a house. The cheapest possible thing to add to a house is square footage. The "core" of the house -- the appliances, utilities, cabinetwork and main structural elements -- represent the bulk of the cost of home construction. Big houses are worth less, on a per-area basis, than small ones.

For the last 50 years, we've been building increasingly sparse neighborhoods of increasingly big houses. In real terms, the cost of ownership has gone up dramatically (heating, cooling, lighting, transportation, maintenance, taxes), while the real value of our houses and neighborhoods has decreased. Both of these scalings are exponential in nature; a modest increase in square footage translates into an exponential reduction in value per square foot.

In 1950, the average American home was 983 square feet. In 2004, it was 2349 square feet. In the neighborhoods most impacted by the building frenzy from 2004 to 2007, it almost doubled again, to around 4000 square feet for new construction. We're talking about a quadrupling of home sizes in 50 years!

Bigger homes require more land, and so density of resources available from these places must scale inversely with the square of home size -- and by the reverse of the argument above, decreasing density introduces higher order scalings whose sum produces an negative exponential effect. So, as homes increase in size, their value will exponentially approach the cost of the raw materials that went into them, until at some point the value falls beneath the associated costs, and owning one becomes a net liability.

The benefits and costs of owning a particular home are tied to labor market conditions, commodity prices, nearby development, and many other things. Thus, the narrower the margin between the benefits and the costs, the more likely the normal fluctuations of the economy will land you with a net liability. Adding leverage into the mix just makes the margins even narrower.

There is the nub of the issue. "Affordable" doesn't mean low price; it means getting a lot of value for a given cost (I am using the terms 'value' and 'cost' in a concrete sense, so you may substitute 'enjoyment' and 'effort' if you like). It means having a comfortable margin between the benefits of home ownership and its associated costs. It means a margin that is wide enough to absorb the risks we face in the event that they become realities. It means that you can still pay your bills if gas prices go up, or if you get a new job, or whatever. This lack of affordable housing doesn't just hurt poor people, it hurts all home buyers. We have a huge glut of houses that have virtually no value in them it all, except maybe as firewood, and almost no available houses with a decent number of readily available resources.

This isn't a situation we can bounce back from through financial mumbo-jumbo. The problem is intrinsic to our built infrastructure. The solution requires physical changes to our landscape. It will take a long time. Much hay has been made about the culpability of Wall Street in this crisis, usually portraying "Main Street" as the innocent victim. This is bullshit. Main Street is just as culpable, and maybe more so. Solving this crisis will require re-writing building codes and zoning laws, not just baking regulations. The crisis will ease up when we have enough compact, high-quality homes in good neighborhoods. By "enough," I mean we have to keep building them until the prices for these places puts them within reach of households at or below the median income.

It really doesn't help that our cultural prejudices insist on equating square footage with value; it is a false economy. Square footage is the high-fructose corn syrup of our financial system; cheap to produce, tragically unhealthy, and no matter how much you have, it never satisfies.

Travel notes (part 1)

Posted by Russell on December 28, 2008 at 2:54 a.m.
After almost fifty-some hours riding the train, I have a few impressions worth sharing. I had a lot of time to think, and a lot of things to think about, so I'm going to break this up into a couple of posts.

I expected to get a great deal of work done in that time, and I accomplished absolutely none of it. Not a single jot. I basically spent the whole trip either looking out the window, or happily asleep. There is just too much to look at; breathtaking snow-capped mountains too numerous to name, scores of towns and a dozen cities, the vast arid emptiness of New Mexico, lonely volcanic prominences rising from Euclidean flatness, knots of green trees rioting in pocket valleys bracketed by sterile sun-blasted volcanic rocks, and the profane, hideous pointlessness of Texas cities.

The trip was a grand tour of the majestic beauty of our country, and an industrial colonoscopy showcasing a great deal of what is wrong and twisted about its economy.

I will spare you my gasping about mountains and trees. I lack the skill with words necessary to even crudely sketch such things. You simply have to see it. Instead, I'll tell you about the ugly and fascinating things I saw. They leave me truly awed.

The first thing that struck me was the vast and penetrating impact of exurban development.

It was heartbreaking to see just how much of the land is already destroyed. In California, luxury homes and golf courses fill every level patch of ground from the outskirts of incorporated Los Angeles to Palm Springs. Tuscon and Phoenix have similar, lower-budget penumbras of sprawling exurbs stretching two hundred miles in every direction. In the space between the outskirts of Palm Springs and the outskirts of Tuscon, people are busily making preparations to link these two cities with a continuous smear of houses. I was relieved to notice that many developments in the margins seem to be abandoned. One of them was nothing but rain-swelled chip-board and wind-tattered Tyvek nailed to dozens of identical frames. I regret that the photos didn't turn out.

That isn't to say that I don't have sympathy for the lives and fortunes that are suffering as a result of the economic pestilence that ruined these ventures, especially the craftsmen and laborers. But the fact is, nobody should be building out there. America's natural spaces should be treated like places of worship. Look at these houses huddling at the foot of this mountain:

These are money changers in the temple. I'm not against money changers in general, but they shouldn't ply their trade in my temple. Actually, this is quite a bit worse than the New Testament parable. The money changers could be thrown out and the sacred space restored. After the developers are thrown out, millions of their innocent dupes remain.

As beautiful as it is, this land is both exquisitely fragile and damn miserable to live on. Fragile because there is so little water, and miserable for its looming and contrarian propensity for devastating floods. Fragile because of the trophic poverty of the nutrient-starved ecosystem, and miserable for its tendency to erupt in sudden racing conflagration. Fragile because of the extreme sensitivity of the wildlife to disturbance -- a few scattered bottle caps have likely doomed the recovery of the California condor -- and miserable for the tendency of the wildlife to apply claws and fangs and venom to pets and loved ones. Fragile for the delicate balance of commodity prices and labor market conditions that make inhabitation possible, and miserable for the stress and strain of living on the knife's edge of financial viability, and doubly miserable when the distant rumbling of our global economic system brings your financial house crashing down on your head.

The only way most people can be comfortable in this kind of place is to obliterate it. Suck dry the aquifers, poison coyotes, shoot the mountain lions and the red-tail hawks, pave the chaparral, relocate factories and office buildings and depots from the distant city, blast and grade the mountainsides for drainage ditches and flood control swails, murder the night with the eyewatering glare of sodium vapor floodlamps. Then what have you got? Just another hot, boring place.

Yes, we can inhabit these places. Such is human ingenuity and power that given sufficient amounts of dynamite, concrete, oil and steel, we can probably live anywhere we can reach. We can blast and pave and bulldoze and burn any landscape to suit our purposes. The great challenge of the 19th and early 20th was to learn how to do these things on the scale required by the lethally difficult lands of the American West. A hundred years ago, life in the Mojave desert was so hardscrabble that few of even the most intrepid adventurers bothered to attempt it. Today, we build full-scale replicas of Scottish seascapes on which we play golf.

The great challenge of the centuries to come will be to abstain from exercising this power, and instead develop better enterprises in which to invest our blood and treasure.

All aboard, and suchlike

Posted by Russell on December 21, 2008 at 12:24 p.m.
Since I've been telling anyone who'll listen for the last couple of years that we've got to use trains for travel more often, I decided that I should take my own advice. I'm going to visit my little sister in Oklahoma, so I'm taking Amtrak there from Los Angeles. I'm taking the Texas Eagle to Fort Worth, and then the Heartland Flyer to Norman, Oklahoma.

It's going to be a long trip (about two days). It could be a lot shorter, but we've been letting our passenger rail service rot for sixty years. I'll post pictures from the trip when I get to Norman, and sooner if I can snipe some WiFi along the way. Until I do, here is a picture of the Capital Corridor train rolling into Davis.

Published!

Posted by Russell on December 10, 2008 at 4:01 p.m.
I just got the email from AIP a few hours ago; my first paper as first author is published!

It was a surprisingly long process. I think most of the delays were due to my own lack of experience. Hopefully, they are lessons learned, and my next trip through the publishing gauntlet will be easier, faster, and hopefully even more fun.

My uncle asked me if I would try to explain what I did in simple terms, so here it goes.

There is a thingy called a tokamak that is basically a very fancy Thermos. It keeps hot things hot. If you can make the stuff inside hot enough, it will work like a nuclear reactor. This is interesting because it is possible to build much better, much safer nuclear reactors this way. The trouble is, these Thermos things cost billions of dollars. The one they are building in France is going to cost something like nine billion bucks, and it will get barely hot enough enough to work as an experiment. Real ones would cost even more.

The good news is that the current designs for these fancy bottles only use a few percent of their heat-trapping capacity. That's what 'beta' means in the title; you can think of it as the heat-trapping efficiency of the machine. This is different from the energy efficiency, though. The heat trapping efficiency is more like how full you can fill the Thermos. Right now, we are building a nine billion dollar Thermos, and only filling it to 2% of its theoretical capacity. If we could use more of the heat-trapping capacity, then you could maybe reduce the cost by a factor of ten or a hundred (or increase the performance by that much).

So, this line of research is all about computer simulations of these doughnut-shaped nuclear Thermoses, and how they behave when they are nearly full.

In some other papers, I helped show that it is likely possible to build a nuclear Thermos that you can fill almost all the way up. In another paper, I also helped my friend Pierre show that it is possible to start with a nearly empty Thermos, and fill it to nearly full without anything bad happening (it all comes down to how you pour, to stretch the metaphor).

Typically, you have a theory that you trust, and you want to know if your computer simulation matches the theory. In this case, however, we built a computer simulation that contained very few assumptions. It solves Maxwell's equations (for magnetic fields and currents) and Newton's equations (for moving masses). This is nice, because those equations have been tested really, really well over the last 130 years. It also means that you can take the output of the computer program, and very easily check to see if it is correct.

As a result, we had the opposite problem one normally faces in science; a computer program that we trusted, and a theory that maybe we didn't. In this paper, I used the computer program to validate that the theory was correct. I did this in an unusual way. The theory is approximate, and so we expected it to go funny in some places. I treated the computer-generated output as the "exact" solution, and showed that when you subtract the theoretical result from the result we got from the computer, the difference is precisely the amount by which we expected the theoretical result to go funny. (In more rigorous language, I proved that the deviation from the numerical result has the same scaling as the error term in the expansion.)

Here is a link to the paper, in case you don't have access to AIP.

Arches

Posted by Russell on December 09, 2008 at 6:59 p.m.
It was a nice day today, so I decided to walk around for a few minutes and take some photos. It was a nice break from studying for finals. I thought this was an interesting juxtaposition.

The arch of an open boxcar I saw today...

...and the Arch of Constantine

What do you think?

Tanta at Calculated Risk

Posted by Russell on December 02, 2008 at 12:29 p.m.
One of my favorite bloggers died on Sunday. I didn't know anything about her personal life until today. She was fighting ovarian cancer with a poor prognosis, and died at 47. Her obit is in the New York Times.

She was probably the clearest, most readable and best informed voice on the mortgage crisis, period. She was also pretty much the only person who had anything positive or funny to say about it. Or, at least she set mood for the general commentary at "dry wit," when it easily could have been "catatonic depression."

From her platform as a co-blogger on Calculated Risk, she wowed people from Nobel laureates to analysts at the Federal Reserve. Pretty much everything I know about the details of the mortgage crisis I either know because she explained it to me, or because she explained it to someone else I read (e.g., certain Nobel laureate economists).

She had hoped to return to mortgage banking after the crisis and after recovering from cancer, but she made such a mark with her writing over the last two years that most people doubt that would have been possible.

One thing that makes big media so stupid is that they always turn to the same stable of pundits for commentary on complex issues. Unfortunately, most of these guys are not very bright and not very informed. But there is a solution. For every issue, even issues as murky and choked with dull tedium as the mortgage banking industry, there are people like Tanta. She was an expert straight from the trenches, but with a view broader than anyone could see from the ivory towers of academia or the skyscraper corner offices of industry. She was exactly the sort of person that major media outlets should recruit for beat reporting. The murkier the issue, the brighter such people can shine.

Alas, this particular glimmer in the gloom has gone out.

Executive bonuses are stupid

Posted by Russell on November 20, 2008 at 1:42 p.m.
This morning my dad sent me a New York Times op-ed by Dan Ariely, a professor of behavioral economics at Duke, on the total idiocy that is executive bonus pay. Here's the main bit :
Of course, there are many reasons to be disgusted with executive pay. It feels unfair that so many people make so much money managing our money, and it is often difficult to see how their talent and abilities justify their compensation. We find it particularly offensive when executives receive high bonuses after disastrous performances. But doesn't the promise of a big bonus push people to work to the best of their ability?

To look at this question, three colleagues and I conducted an experiment. We presented 87 participants with an array of tasks that demanded attention, memory, concentration and creativity. We asked them, for instance, to fit pieces of metal puzzle into a plastic frame, to play a memory game that required them to reproduce a string of numbers and to throw tennis balls at a target. We promised them payment if they performed the tasks exceptionally well. About a third of the subjects were told they'd be given a small bonus, another third were promised a medium-level bonus, and the last third could earn a high bonus.

We did this study in India, where the cost of living is relatively low so that we could pay people amounts that were substantial to them but still within our research budget. The lowest bonus was 50 cents — equivalent to what participants could receive for a day's work in rural India. The middle-level bonus was $5, or about two weeks' pay, and the highest bonus was $50, five months' pay.

What would you expect the results to be? When we posed this question to a group of business students, they said they expected performance to improve with the amount of the reward. But this was not what we found. The people offered medium bonuses performed no better, or worse, than those offered low bonuses. But what was most interesting was that the group offered the biggest bonus did worse than the other two groups across all the tasks.

My dad asked, "Surprised?"

Nope. Not surprised at all.

The whole theory of executive pay is based on a slightly different idea than motivation. Boards are not exactly trying to motivate their executives to perform, they are trying to attract what are invariably described as "the highest caliber" candidates. It works if you assume that ability is some kind intrinsic property of humans, and that if you dangle a big reward in front of a big group of people, the most able ones will triumph and seize the prize. It's naked social Darwinism. That's what people mean when they talk about people's "caliber," or whatever. It's sloppy thinking, and sloppy thinking usually gets the sloppy thinker into trouble. A gigantic, world-girding economic catastrophe, for example.

I think bonuses fail for an even simpler reason than Dr. Ariely suggests: In a strictly scientific sense, there is no such thing as a smart person. There is no way to rank human beings based on cognitive skill in any meaningful way. In fact, it's not even clear we can define "cognitive skill." It's a 19th century idea that has been so thoroughly debunked that it has become a kind of parlor game for psychologists.

There are a lot of reasons for this, but chief among them is that we do not, in any substantive way, understand the nature of intelligence. We may think we know it when we see it, but we have no way of measuring it.

Tests of intelligence are actually on worse scientific footing than those people you see on TLC videotaping empty hallways through osmium-doped filters in the effort to prove the existence of ghosts. At least the ghost hunters are usually honest about their total lack of evidence, and at least there is some reasonable expectation that if there were ghosts, that you would would see them on the tapes. The College Board, and ETS, and pretty much every professor engaged in teaching that I've ever spoken with lack even the intellectual honesty of crackpot ghost hunters.

Clearly, there is variation among people when it comes to performance of specific tasks. Some people are really good at memorizing sequences of numbers and repeating them back in some carefully jumbled order. This is usually taken as an indicator of mathematical ability. Nevertheless, I find that I cannot memorize sequences of numbers to save my life, but that doesn't stop me from doing quantum mechanics.

So, once we've measured everyone's performance on the regurgitating-numbers-test, and put everything in a big table and sorted the table by score, what have we learned? Well, not very much. We might be able to draw some conclusions about people in general, perhaps, by correlating performance on the test with choice of breakfast cereal, or whatever. But it doesn't tell you anything of significance about an individual test subject.

However, it is usually possible to tell a smart idea from a dumb one. Unlike people, ideas can be subjected to detailed analysis. They can be examined for internal logical correctness. They can be modeled by equations, or simulated, or tested empirically, or compared to historical data for similar situations and the results considered. They can be slotted into a multiplying zoology of ready-made intellectual frameworks, and poked and prodded and stretched and tortured in all sorts of interesting ways. They can be placed head-to-head with other ideas in the analysis gauntlet, and in many cases it is possible to pick winners, or at least to triage pretty good ideas from dumb ones.

It's more work to pick smart ideas ideas than to pick smart people because the techniques we have for picking smart people are a fraudulent mummery that can be conducted with hardly any work at all. And lo, we see that systems in which ideas compete work very well (e.g., science), and systems in which people compete are either totally artificial (e.g., sports) or tend to function worse than had you picked the players at random (e.g., business, politics).

If you dangle a big reward in front of a big group of people, all you really know about the person who seizes the reward is that you have found someone who is good at taking large amounts of money from people. If I were looking for someone to run my company, I would be suspicious of such a person.

A National Infrastructure Investment Fund

Posted by Russell on November 08, 2008 at 5:24 p.m.
There were a lot of remarkable things about Obama's campaign, but one of the most significant aspects is that it was funded by millions of ordinary people who could only muster small donations. I've been thinking a lot about how that model could be turned bigger problems. Here's what I've come up with so far.

Most people set aside part of each paycheck for a variety of things. 6.2% of each paycheck (up to $102,000) pays for contributions to Social Security, 1.45% goes to Medicare. Then there is income tax withholding, contributions to 401k plans, health plan co-payments, and so on. I think we should create an additional voluntary withholding item with a variable rate that would feed into a fund that invests in revenue generating national infrastructure.

The idea is to offer taxpayers an investment option with a risk profile somewhere between Social Security (which is designed to be a sure thing) and a 401k (which can be lost completely). Contributions would be invested only in critical national infrastructure projects, like transport and renewable energy. The investments would be structured so that they would pay dividends. For example, the fund could build wind turbines, and the dividends would come from the electricity revenue.

This would help solve three problems :

  • It would give taxpayers a relatively safe investment option. The dividends might fluctuate from year to year, but the investment could never be lost. This would provide a nice compliment Social Security and a 401k.
  • It would create a pool of money designated for projects of crucial national importance. The fund would be big enough that it could invest on a scale impossible for private equity. Also, the focus on generating long-term reliable revenue instead of capital gains would allow the fund to invest on a much longer time horizon than most private equity.
  • It would bring patriotism, volunteerism and ecological-mindedness into alignment with individual financial self-interest.
I suppose similar things exist in the private sector already, mainly in the form of green mutual funds and suchlike. I've never been very impressed with them. Mutual mostly seem to focus on capital gains, which seems like a crummy way of monetizing basic infrastructure like electrical generating capacity. These funds are also generally very small, which means they cannot invest directly in projects and they have high overhead expenses.

I'm not interested in yet another speculative investment option. The private sector does a good job there, and doesn't need to be duplicated. I'm thinking of a different sort of model, more like social entrepreneurism, but with mass-participation.

This One for That One

Posted by Russell on November 04, 2008 at 1:01 p.m.
A lot of people fought long and hard to give me the right to a secret ballot. This time around, though, I'm happy to show it to anyone who cares to look.

I like this ballot system much better than the InkaVote thing they have in LA, and much better than any kind of computerized bullshit. I spent four years using computers to design fusion reactors, but I sure as hell don't trust them with an election. Pen and paper, thanks.

The radio says

Posted by Russell on November 04, 2008 at 10:30 a.m.
Normally, I really, really hate mornings. When my radio clicked on this monring, it was in the middle of a country song. The first lyric that came up was, "I'm so tired of Mr. Wrong, I'm gonna find me a Mr. Right." That was the first time I've woken up laughing in years.

I'm going to fix myself a nice steaming cup of democracy.

My very own ballot initiative

Posted by Russell on October 29, 2008 at 1:58 a.m.
I propose a ballot initiative to amend California's constitution to end ballot initiatives. Who's with me?

I like the idea of a little direct democracy, but it if I'm going to be expected to cast votes on these damn things all the time, then I want my damn legislator's salary. The initiative process should be reserved for extremely serious problems, like succeeding from the union if the Republic gets overthrown by evil blob aliens, or whatever.

What should be proposed, exactly? What if initiatives needed to pass at 66 percent? Or maybe if we required that a third of all California voters sign the petition to get it certified? How do we get rid of these damn things?

Tax cuts are stupid

Posted by Russell on October 26, 2008 at 3:27 p.m.
Continuing on yesterday's theme, here is another thing that is stupid: Tax cuts. Now, I don't especially like paying taxes, but if given the choice, I'd take a raise over a tax cut any day. A pay raise for me means that not only am I wealthier, but everyone is wealthier. A tax cut means I'm getting a little wealthier at the expense of others.

But that's just my personal preference. Others may feel differently. However, there is another very simple economic reason why tax breaks are a stupid way of encouraging businesses, especially new industries. As Todd Woody writes, if you give a generous tax break to a small company, it often doesn't have the income to take advantage of the incentive. So, it has to form a tax equity partnership with another company that can use the tax break. With the credit markets screwed up, and Wall Street burning equity like books at Bebelplatz, it's gotten pretty damn hard to put together tax equity partnerships. Not to mention that if you are big company taking large losses, your writeoffs probably provide all the tax relief you need.

Under good conditions, the senior partner in the tax equity partnership often stands to gain a lot more than the junior partner, and the incentives end up helping the wrong people. Under current conditions, few companies are lucky enough to actually need a tax equity partnership with a scrappy little solar company with big plans. End result: a lot of those tax breaks are worthless to the people they are intended to help. Worse still, the more urgently the help is needed (like when the economy stinks), the more useless the tax breaks become.

So, enough with the tax breaks. They are stupid. If the government wants to help establish a new industry, as it did with semiconductors, the internet, and electricity, there are much more sensible options. For example :

  • Invest directly, especially in R&D.
  • Establish public trust funds to take equity positions in promising companies.
  • Agree to buy the product at a predictable price.
That last one is probably the most important right now. The federal government is huge. When it makes significant purchases, it is big enough to jumpstart whole industries. That is how the semiconductor industry got off the ground. If Congress wants to get the solar, wind and geothermal industries rolling, it should simply agree to buy all the electricity they can make, and to hell with tax incentives.

SonicWALL is stupid

Posted by Russell on October 25, 2008 at 5:06 p.m.
While I'm greatful that Peet's Coffee and Tea provides Wifi for people who buy coffee from them, I think their censorship software is very, very stupid. Take this salacious image, for example :

SonicWALL brilliantly flags this as 'Pornography.'

Seriously. This is a huge waste of everyone's time and money just to make sure nobody sees any boobies.

On calling the end of the financial crisis

Posted by Russell on October 14, 2008 at 9:46 p.m.
I was wondering how we'll know when the credit crisis is over, and I thought I'd share my gloomyness with you, dear readers.

The Big Money people invested vast amounts of capital in malls and condominiums, and now they have to come to terms with the fact that these things are not productive assets. All of that capital was blown on green lawns and shiny baubles, instead of invested in equipment and training. Now the capital is gone, with nothing to show for it but a bunch of luxury stucco boxes in the desert with no schools, no jobs and no water rights.

You'll know we're near the end of it when they start bulldozing abandoned subdivisions and planned communities. That's the reality of the situation; we built too much housing, we built housing of the wrong type, at the wrong size and scale, with the wrong materials and the wrong technologies, and we built it in the wrong places. Until Americans face that reality, the financial system will stay broken. But once the bulldozers get to work, you can be pretty sure that the reckoning is underway, and the stock prices you see are close to honest.

The metric for recovery that I'm keeping in my head is this; when it becomes profitable in Southern California to buy up a bunch of crappy houses, tear them down, plant some orange trees, and sell the oranges, then we're good.

Bad Django, no cookie

Posted by Russell on September 25, 2008 at 4:54 p.m.
A few days ago, the new Django 1.0 packages got installed on our colo machine. Evidently, the Django people decided to break a whole ton of stuff. It took me a couple of days of desperate hacking to get the site up and running again before classes started.

Bad Django. No cookie.

Weak sauce

Posted by Russell on September 25, 2008 at 3:17 p.m.
So, it looks like once again, the Democrats are letting themselves get stampeded into yet another colossal Whitehouse-hyped fiasco. Everyone is so very impressed with Henry Paulson and Ben Bernanke, and their wonderful credentials, that they're willing to take their bullshit at face value. Remember Colin Powel's photos of Iraqi mobile weapons labs? Remember the incredible haste with with which Congress was forced to ram through amnesty for treasonous telecommunication companies? Remember the $300 billion we blew on the Economic Stimulus Act of 2008? Like most Americans, I sent most of mine to the Saudis. Pfft.

I am continuously astonished by the ability of conservatives to refuse to, you know, conserve. When difficult times come along, there is somehow always a refusal to prioritize and make sacrifices. That doesn't make the difficult times go away, so instead we end up sacrificing important things instead of unimportant things. For example, when it was clear a few months ago that consumer spending was flagging, it was decided that putting a few extra dollars in the people's pockets would help.

What did Congress do, at the urging of the Whitehouse? It borrowed the money. If that were the only way to put a few hundred bucks in people's pockets, then so be it. But it wasn't. One of the things that was taking money out of people's pockets was the spike in gasoline prices. Push prices down, and everyone who uses gasoline would be that much richer. What's the simplest way to reduce gas prices? Why, to use less of it, of course. What's the simplest way to do that? Impose a speed limit. Duh.

A conservative financial decision would have been to lay it out to the American people this way: We can either borrow the money to give to you, and then make you pay for it with higher debt maintenance payments and higher taxes, or we can impose a 55 MPH speed limit for 200 days. Now, driving 55 sucks, but don't you think it'd be worth it to avoid running up the debt? Don't you think it'd be worth it for lower prices and a little extra money in your pocket every week?

But no! Driving huge vehicles far, fast and for no reason is the American Way of Life! It's evidently more important to protect the sanctity of the gas pedal than to safeguard the solvency of our republic.

First actual week of grad school

Posted by Russell on September 24, 2008 at 1:28 a.m.
When it rains, it pours! I've been hanging around all summer wondering what to do with myself, and now suddenly there is a huge explosion of activity. After a four day expedition to Davis to sign paperwork at Graduate Studies, register for classes, look for a job, look for an apartment, and get a sense of what it will be like to live here, I drove back to Los Angeles for my cousin Nathalie's wedding (Sunday) and my great aunt's 88th birthday (Monday). Both were beautiful. Then I packed my car and drove back to Davis this afternoon.

Tomorrow, I have a job interview and tour for an on-campus job working in one of the Department of Entomology greenhouses. Not quite as good as a TA position, but it would pay for rent and get me outside and moving around on a regular basis.

I still haven't found a place to live yet, but a very nice fellow from my department is letting me crash on his living room floor until I do. Classes were supposed to start Thursday, but evidently the professor for that course isn't here yet.

Off to Davis

Posted by Russell on September 15, 2008 at 2:36 p.m.
The student affairs officer at UC Davis said that there are possibly some TA fellowships still available from other departments. I want to make sure I get one, so I'm jumping in my car and driving to up to Davis with a couple of crumpled bills in my pocket, a shopping bag of canned soup, and an empty bank account.

Ah, adventure! I'll try not to get E. coli poisoning this time.

Copy editors needed

Posted by Russell on September 14, 2008 at 10:36 p.m.
It looks like the New York Times was seriously shocked by Sunday's news. So shocked, it seems, that that they left grammatical errors all over their headline story about Lehman Brothers :
A.I.G. will be the next test. Ratings agencies threatened to downgrade A.I.G.’s credit rating if it does not raise $40 billion by Monday morning, a step that would crippled the company. A.I.G. had hoped to shore itself up, in party by selling certain businesses, but potential bidders, including the private investment firms Kohlberg Kravis Roberts and TPG, withdrew at the last minute because the government refused to provide a financial guarantee for the purchase. A.I.G. rejected an offer by another investor, J. C. Flowers & Company.
I think the copy editors must have been on the phone to their brokers.

Grad School

Posted by Russell on August 29, 2008 at 6:38 a.m.
Evidently I'm going to graduate school. I'm just not yet sure where, or what I shall study. Decisions, decisions.

First Sourdough!

Posted by Russell on August 07, 2008 at 8:56 a.m.
My first attempt at sourdough bread seems to have produced a pair of unexpectedly tasty results. I was rather skeptical that this would actually work the first time. The taste came out much better than I had hoped for; awesome sourness, but not so sour as to overpower the flavor of the wheat. These are 50% whole grain, so they have some nice texture from the bran, but are still chewy and moist.

The boules didn't quite shape up the way I wanted them to, and sort of spread out on the baking pan once they came out of the bannetons. That's why they're more disk-shaped than sphere-shaped. Also, I didn't attempt anything fancy with the crust.

I cultured the starter from stone milled rye flour, and fed it alternating whole wheat and white flour every 12 hours for two weeks. The starter was the only difficult part. I killed my first starter by accidentally overheating it in my makeshift incubation pan. I gave up on the precise temperature control, which seems to have produced a somewhat less lively starter. It lifts the dough just fine, though.

The ingredients were :

  • 1/4 cup starter
  • 3 cup whole wheat flour
  • 3 1/2 cups white bread flour
  • 2 1/2 cups water
  • 2 tsp salt
I know it's better to use grams than cups for measuring flour, but I don't have a good bench scale yet.

This made two loafs, which I put into bannetons for 12 hours of rising. I baked them for 45 minutes at 375F, with a pan of water bubbling away at the bottom of the oven.

I made the bannetons from some small fruit baskets that were sitting around attracting junk accumulation. I made the liners by reclaiming some nice raw linen that was part of an IKEA laundry basket that had fallen apart at the seams (carefully washed, of course). I floured the banneton liners carefully, so they didn't stick much at all.

Um, where are the issues?

Posted by Russell on August 02, 2008 at 10:49 p.m.
I thought the whole point of nominating John McCain was that he was supposed to be the honerable candidate, and that he would take on the issues with the Democratic nominee. You remember the issues, right? Our assorted wars, our collapsing banking system, forclosures, the energy clusterfuck, torture, wiretapping, abortion, global warming, gay rights, taxes, the budget -- that stuff.

So, uh, when is he going to get into that stuff? He is seriously going to talk about Paris Hilton? WTF?

An endorsement withdrawn

Posted by Russell on July 15, 2008 at 4:41 p.m.
After taking a few days to think about it, I've decided to withdraw my endorsement for Barack Obama. I've removed the campaign logo and links from my site to indicate this decision.

To be clear, I do hope he wins, and I will vote for him. I hope he finds a way to win back my endorsement. However, I simply cannot actively support him after his vote on FISA.

Kudos to Obama for his artfully penned response to the gigantic groundswell of outrage, but this is something that leaves me profoundly disappointed. FISA was an unnecessary, rotten, law to begin with, and this law takes it from rotten to putrid.

Let me put it this way. Say you are an FBI agent, and you are working on a case. You think you need a wiretap ASAP. If you don't feel that the case is compelling enough to wake a judge up at 4 AM to get her to sign a warrant for your wiretap, then the agency probably shouldn't waste its time and resources pursuing the case.

The whole reason for requiring warrants to search and seize property is to focus law enforcement on compelling cases. The system is designed to weed out speculative and frivolous investigations, and investigations for improper purposes (political intimidation, for example). The administrative burdens placed on law enforcement are SUPPOSED to be burdensome. Sure, we should feel sympathy for the plodding investigator as he navigates through the red tape. But we should also recognize that the hassle he must undergo is a sort of administrative calisthenics. It makes for more thorough investigations, more accountable practices, and more successful prosecution.

If we want to help our hypothetical plodding investigator, we shouldn't make his job simpler. We should give him more material resources. Worried about not getting warrants quickly enough? How about expanded staffing to process warrants? Better IT infrastructure to handle the process faster and more efficiently? Or heck, why not just set aside office space for judges nearby the operations center? Processing warrants is one of the key duties of serving on the bench, and in my experience, judges generally take all parts of their jobs very seriously.

Even if we grant, for a moment, the ridiculous "ticking bomb" scenario that seems to motivate all conservative thinking on domestic security, special legal "tools" like FISA are still totally unnecessary. Terrorism cases are not unique in the urgency with which they must be pursued, or in the scope they must cover, or in the potential number of victims. Ordinary homicide investigations can be just as urgent; racketeering and organized crime cases can be just as broad in scope; environmental cases can involve just as many victims. Terrorism is unique only in the sense that it can potentially combine these aspects. Terrorism cases are bound to be complex and difficult, but the difficulties have nothing to do with complying with appropriate judicial oversight. Any competent homicide detective knows how to obtain a warrant when she needs one in a big hurry. The FBI organized crime people know how to obtain warrants for complex investigations. Investigators who handle environmental cases often use the potential for mass casualties to obtain authorization to conduct wide-ranging investigations. Terrorism investigators need to do all those things at once, and so they need low caseloads, a lot of very competent support staff and a well-run computer network.

As with any other class of investigation, we should not expect better results by relaxing judicial oversight, or in the case of the new FISA law, no oversight whatsoever. Quite the contrary. Exception from the fourth amendment allows more latitude for sloppy work, but won't help an honest cop catch any bad guys. What conservatives are really asking for when they rail against judicial oversight is that they don't want honest cops; they want Gestapo.

Naturally, conservatives don't want the EPA or the Forrest Service to have expanded investigative or enforcement powers. Extra-constitutional intrusions into the private lives of Americans are evidently reserved for manly things. For girly things, like protecting spotted owls from logging companies and children from arsenic poisoning, conservatives never fail to come out in favor of judicial micromanagement. This works in concert with their habit of appointing industry lobbyists to the judiciary.

What angers me about Obama's position (and the Democratic leadership) here is that they conceded a fundamental philosophical point to the GOP. They are granting that security theater is more important than the law. Not only that, but in the same stroke, they endorsed the criminal behavior of the people involved in what is probably the largest and most serious breach of the fourth amendment in our history. I cannot abide it.

I will vote for Barack Obama, but I'm not going to endorse him, or give him any more money. Instead, I encourage you to contribute to the Electronic Frontier Foundation.

First day of solar production

Posted by Russell on June 04, 2008 at 12:56 a.m.
The contractors installed the last row of panels this morning and switched on our solar array. Our house now produces about 15% more electricity than it uses!

The array produces between one and three kilowatt-hours for every hour of sunlight, so for today's half-day of production, we've generated 13 kwh.

Here's the read-out on the inverter :

Sadly, I don't have a way of getting the data out of the inverter yet. Once I add the RS-232 module, I'll have have more interesting things to say about our system. I'll post some pictures of the array itself once we've passed inspection.

The Sunny Boy inverter has an interesting user interface. There aren't any buttons -- you interact with the display by knocking on the front panel with your knuckle.

Make it stop, make it stop!

Posted by Russell on June 02, 2008 at 5:26 p.m.
A friendly reminder to those who are following the nomination process: Party primaries are not national elections. Political parties are essentially private clubs. Subject to a few basic limitations (e.g., Brown v. Board of Education), they can make up whatever rules they like. If the Democratic Party wants to select the presidential nominee via a dance-off, or a hip-hop battle, or an egg toss, that is perfectly legal.

I keep reading about how the party isn't allowed to take away Florida and Michigan's delegates. Of course they can; it's a private club. In fact, their rules stipulate that they must strip the delegates in this circumstance.

It's obvious to everyone that the nomination process isn't perfectly equitable, but the system we have now is a huge improvement over the smoke-filled-room method of the very recent past. Hillary Clinton has raised some important objections to how the system works. That's good. It needs improvement. However, winning the nomination and fixing the nominating system should not be conflated. This is her party, after all. She's been extremely influential in the party for almost sixteen years. If she wants to advocate for reforming the process, then she was welcome to spend some of those sixteen years of influence, you know, influencing. After the election is over, if she uses her influence to push for reform, that would be a great service to the party and to the nation. But pushing for reform in order to win isn't good for anyone.

I should point out that the general election system isn't exactly perfect either. Any competent candidate must demonstrate the technical abilities needed to campaign and win, fair and square, even in a system that is unfair and warped. I should also add that the Democratic nomination process and the general election process closely approximate a fair and equitable system, to a precision of a percent or thereabouts.

Elections are political instrumentation. They measure the prefrences of large groups of people. Say, for example, that you take a measurement with a volt meter. It reads 5.13V, plus or minus 0.5%. It's not acceptable to write down 5.17V because you think the probe contacts are a little dirty, and that's throwing off the measurement. However good your intuition and experience, that's called fudging your numbers. If doesn't change the results, then a little fudging won't do much harm, even if it is bad methodology. If it does change the results, then it's fraud. Bad scientist. No tenure.

Solarizing!

Posted by Russell on June 01, 2008 at 9:37 a.m.
Our contractor, EE Solar, is about halfway finished with the solar installation at our house. Here is what they are installing :
  • 14 SunPower 230 watt panels
  • One SMA Sunny Boy 3000 inverter
  • A second digital utility meter
  • AC and DC disconnects with lockout-tagout switches.
The 14 panels will be arranged into two arrays with south-facing exposures producing 3220 watts of DC power. The inverter is about 95% efficient, so the nameplate capacity will be 2854 watts. The USGS indicates that we should get about seven to eight hours of usable sunlight per day on average. The array should produce an average of 17 to 20 kilowatt hours a day. This should easily cancel out our usage, and maybe a little beyond. I'm hoping for slightly better production, since Pasadena is higher and dryer than most of the LA basin.

Here is the equipment after delivery and upacking :

We were supposed to get a Sunny Beam monitoring station, but evidently there are some issues with buggy firmware, so they won't be available until September (more about that later).

So far, roof has been preped, the mounting rails are installed, the conduits are bolted in place, the DC wires are pulled, and the inverter has been bolted down. All that's left is to hang the panels, do the AC wiring, and get the inspection.

The installer crew was supposed to finish that on Friday, but evidently they decided to take the day off. The project manager at EE Solar pitched a fit. Nick, the crew boss, called on Friday to say he was really sorry. I told him that his schedule is his business, but if he can't come when he promised, he ought to let us know. On Moday, I'll ask him to run some extra conduit for ethernet to make amends.

Red Fred, 1990-2008

Posted by Russell on May 30, 2008 at 7:09 p.m.

In 1990, my family moved to Ohio. If you've ever talked to me about it, you know that I don't have many happy memories to relate about the experience. However, in Ohio, I gained a great friend.

Soon after we moved, my parents left for some sort of vacation. I don't remember where they went. My mother was taking classes at Wright State, and one of her classmates and her husband stayed at our house to keep my little sister (and me, I suppose) out of trouble. They brought their cat with them, who was not quite fully grown.

This was a very unusual cat. He was still a kitten, but he had none of the usual kitten hyperactivity. He was always utterly calm. He showed a keen interest in everything. He would peer down the sink drain intently, explore behind and underneath every piece of furniture, and sniff every plant in the garden. If you were eating something, he would wait patiently until he was allowed to examine it. Usually he didn't want to eat any, he just wanted to have a look and a sniff. He explored avidly, but carefully, methodically, and patiently. He had none of the aloofness or disdain that cats often show. His interest was genuine, but he just wasn't excitable.

He never made a sound. Not for any reason.

He was affectionate, but not attention-seeking. If you picked him up, he would purr, but he never bothered you for attention. When he wanted food, he would sit at his bowl and wait, patiently, and sometimes for hours.

My mother's friends felt bad keeping him in a small apartment, and they were going to move after they graduated. When my parents returned, they let us keep their cat. He was a beautiful orange tabby, and so they had named him Tigger. However, his personality had turned out so utterly un-Tiggerlike that we felt compelled to give him a new name. So, I named him Red Fred.

Fred grew into a massive, powerful cat. By the time he was five, he was a solid rectangular block of cat muscle, weighing perhaps eighteen pounds. He could easily have been the alpha cat, but he was uninterested. He left the alpha cat position to PVP (that name is another story), who was scrawny by comparison. Fred continued to patrol the neighborhood, evidently spending most of his time observing things. He would sit at the bottom of the driveway and watch people walking along the sidewalk for hours, or on fences staring into people's kitchens.

Whatever he did, there was a solemnness about it. He made you want to be quiet around him, so as not to disturb his observation and reflection.

When he hunted, he never bothered with birds or mice, and instead caught full-grown rabbits. As far as we know, he did not eat them. He would carefully carry them into the kitchen by the scruff of their necks, like kittens. He would then release them, and watch the resulting mayhem with interest. Some of the rabbits he caught were heavier than our other cats, and there was always a lot crashing about and shouting as we tried to expel them from the house.

He was also utterly trusting. One evening, he came to the door with a huge gash in his side, opening his flesh from his belly to his spine. He let my mother pick him up with just a small flinch. If you've ever had to work with an injured animal (or an injured person), you know how unusual that kind of self-control is. When she took him to the vet, he sat stoically on the examination table as they cleaned his wound and stitched him up. The vets were utterly astonished; there were three assistants in the room to hold him down, but they had nothing to do. They stood and watched as Fred bravely went under the needle, fully aware of what was happening. He still never made a sound.

Many years later, his friend PVP died. Thought his long life, PVP maintained a constant monotonous litany of hoarse, solemnly discordant meows. Fred found his body in the garden, and uttered his first sound. My mother came running to see what the strange noise was. After that, every few weeks, Fred hid himself alone in a closet or in the basement crawlspace, and imitated PVP's meow, eventually stretching it into a long, deep yowl. It was an eerie sound, much too deep, loud and extended than one would imagine could come out of a cat, or even a person. It sounded like he was on a PA system. He would do this for a few minutes, and then emerge from his hiding place as though nothing had happened. After that, this ritual became part of his life.

There are lots and lots of great stories about Fred, but they all share a common theme: Fred was a sage. I'd like to think that if there is such a thing as reincarnation, then he must have been a tulku, maybe taking one last look at the world.

On Tuesday, he had a stroke, and died without pain among people who love him. He was about nineteen years old.

4.01

Posted by Russell on May 19, 2008 at 1:56 a.m.
For the first time, I just paid more than $4 a gallon for gasoline. It cost $40.34 to fill the tank on my tiny Toyota Yaris. My commute to UCLA is 37 miles each way, and I get about 38 MPG for that trip. I normally do a little better, but the Sepulveda Pass always seems to wreck my milage. At about $0.11 a mile, one trip costs me $7.77. If I drove in every day, it would cost me about $155 a month. That's almost as much as the payments on the car. If gas goes up another 84 cents, then I'd be paying more for the gasoline than the car just from driving to school.

Ouch.

Meanwhile, a Metro day pass costs $5, and a month pass is $62.00. If you commute in LA, chances are pretty good that your employer will buy your pass for you.

Mazel Tov

Posted by Russell on May 15, 2008 at 10:36 p.m.
The Supreme Court of California has ruled that the ban on same-sex marriage is unconstitutional. Even the dissenting justices wrote that they support same-sex marriage -- they are of opinion that it isn't mandated by the California constitution.

Honestly, I was expecting it to go the other way.

Patt Morrison had a lawyer for the losing side on her show a few minutes ago, and he basically framed his position this way: Allowing same-sex couples to get married places personal choice above community standards. Allowing people to ignore community standards will erode the morality of our culture. That sounds like a pretty weird argument for a supposedly conservative point of view.

When it comes to something as private and personal as marriage, let community standards be damned. America's uniqueness flows from its protection of personal liberty, even when that means protecting things that you would not do yourself, or that make you feel uncomfortable when other people do them. I've visited the Harmonious Society, and I like it here better. A lot of blood has been spilled over the years for the liberty we now enjoy. If living in a free society means we have to watch dudes kissing on TV, I'd say that's a bargain price for a lot of protected liberty.

Mazel Tov.

The famous Chinese smog

Posted by Russell on May 04, 2008 at 9:50 a.m.
When I was little, we used to have Smog Alerts in Los Angeles fairly regularly, sometimes for a few consecutive days. My elementary school used to keep us inside on those days, and I used to stand on the second floor balcony that overlooked the foothills, staring at the crap in the air. Around noontime, it looked like an overcast sky, but without the ceiling effect. It diffused all the way to the ground. Then, in the afternoon, the sky would explode in a malignant display of colors. The horizon was capped by a black line hovering above the ground with a mantle of crimson and orange, like the lips of a steamed muscle. The sun would squat over the ocean in a rust-colored splotch smeared across a quarter of the sky. Shadows turned the color of tea, and the air turned pinkish and cloudy like you were peering through gasoline. It looked genuinely dangerous.

Astonishingly, those days were a measured improvement over what my parents experienced. The smog used to be thick enough to obscure the sun completely, turning the daylight into a diffuse glow. Sometimes, it blocked enough of the daylight to create a sort of murky twilight. Here is the first known photo of LA's smog, from 1943 :

Beijing is like that, except the mantle of smog is much, much wider than the one that covered Los Angeles in its worst years. For the Olympics, China has been working to improve the situation, but the progress so far is not very impressive. Days with good air quality, called "Blue Sky" days, would be emergency smog alerts in Los Angeles. The Beijing Air Blog has some interesting data on China's ongoing battle with air pollution, though there haven't been many posts in a while. Here is Tienanmen Square on April 27, 2008, which was officially a Blue Sky Day :

The smog extends pretty far from the city. This is the shot from a train window about a hundred miles north of Beijing. The factory (refinery? LNG plan? cement factory?) is only about a mile or two away, and it's almost completely invisible.

I'm not going to delve into why this is a bad thing. Global warming, cardiopulmonary disease, lead, mercury, yadda yadda. You already know the arguments, or you can make your own. Here's a reason that doesn't require any sort of scientific background to understand. The day after I took the photographs above, a heavy thunderstorm scrubbed the smog out of the sky. This is what China is supposed to look like :

China is a damn beautiful country, when you can see it.

One week in China

Posted by Russell on April 29, 2008 at 10:33 a.m.
I keep meaning to sit down and write a blog entry about what it's been like so far, but things keep happening at a break-neck pace, and I just haven't had time. I only have a few minutes to write something, so I'll write about one of the small annoyances of this crazy place: Plumbing.

As everyone knows, China is making a huge effort to modernize. For the most part, it has been quite successful. In America, we mostly experience China's modernization in the form of the ever-escalating technical complexity of Chinese imports. Not so long ago, only crappy plastic toys and knock-offs had Made In China stickers. Today, you are probably reading this post on a computer made mostly out of parts bearing the same imprint. However, the overwhelming majority of China's modernization is for domestic consumption only. The streets are jammed with cool Made In China products that you will never see in America. The electric scooters, for example. The cell phone service is better in your average one-horse Chinese village than it is in Los Angeles.

Americans tend to assume that most of China's economy is geared toward exports; it isn't. The flood of Chinese goods we see coming into the Port of Long Beach is just the oversplash of China's industrial berserker rage. Most of it stays right here.

On the other hand, they don't seem to have quite figured out plumbing. I was trying to figure out why my 17th floor hotel room always smells like a sewer. It occurred to me that maybe there was something wrong with the drain. Notice anything missing?

That's right. No trap. From the booming roar that issues from the drain every time I use it, it sounds like it's a pretty straight shot from the sink to the sewer main in the basement, seventeen floors down.

Whoever designed this fixture was clearly aware of this problem; the drain has a built-in airtight, noise insulated drain cover. They opted for a heavy rotating high pressure plug instead of a little bendy bit in the pipe.

As Mimi would say, "That's China."

Disco Bay

Posted by Russell on April 24, 2008 at 12:56 a.m.
From somewhere above the Mongolia/Siberia frontier.

I suppose it is somewhat fitting that, on my way to visit the planet's newly crowned Number One Emitter of carbon dioxide, I should get a fantastic view of the patch of the planet that all this carbon dioxide is having the most dangerous effect. I visited Greenland in 1993, so it's interesting to see what it looks like 15 years later. Normally I think out-the-window shots are pretty crummy, but I think these make up for their poor image quality and composition by being pretty damn interesting.

This is the ice pack on the Davis Straight, between the west coast of Greenland and Canada. As you can see, there really isn't any pack ice. In August of 1993, we had planned to sail across the straight to visit the Baffin Island. We had abandon those plans because the pack ice was too heavy to navigate, even for our specially equipped vessel. We had to hug the coast of Greenland, following shipping lanes kept clear with ice breakers.

This is the west coastline of Disco Island. In 1993, it was kind of impossible to tell where the pack ice ended and the island started. Now, it's pretty obvious. After we visited Disco Island, we spent a few rough days hammering our into Baffin Bay. The noise of the ice crashing against the hull was awful. Imagine being trapped in a garbage can while someone beats it with a chandelier. We gave up and turned around after a few days of it.

This is Disco Bay. In 1993, I remember standing on the Greenland side. The pack ice on the bay had ruptured, but it was very thick and clogged with icebergs. The noise of the ice grinding and grumbling on the chop was so loud that it was impossible to have a conversation without shouting. Now, it looks like the Charles River in Boston around springtime.

Here is a glacier on Disco Island, just 'cause it's awesome.

A plauge of duplicates

Posted by Russell on April 19, 2008 at 7:47 a.m.
I have a bad habit. I often open my IMAP mailbox directly on the mail host with mutt. This inevitably causes occasional complicated messes when I butterfinger something. For example, a few days ago I accidentally moved all of the read messages to a separate mailbox. I merged the message back in, but not before my desktop, which was patiently monitoring my IMAP mailbox on the other side of town, decided to synchronize a few thousand messages with the IMAP server. This resulted in lots and lots of duplicate messages.

The trouble was, the duplicate messages had different X-IDs so, their MD5 hashes would be different. After fiddling around with formail for a few minutes, I got impatient and banged out this fun little Python hack :

import email, imaplib, getpass

M = imaplib.IMAP4_SSL( '**********' )

typ, data = M.login( getpass.getuser(), getpass.getpass() )
if typ != 'OK' :
    raise Exception, 'Login failed.'

typ, data = M.select()
if typ != 'OK' :
    raise Exception, 'Selection failed.'

typ, data = M.search( None, 'ALL' )
if typ != 'OK' :
    raise Exception, 'Could not get message IDs.'

id_list = data[0].split()
mids = []
for id in id_list :
    typ, data = M.fetch( id, '(RFC822)' )
    if typ != 'OK' :
        raise Exception, 'Could not fetch message ' + id
    mail = email.message_from_string( data[0][1] )
    mID = mail.get( 'message-id' )
    print mID
    mids.append( (mID, id) )

mids.sort()

dupes = []
for i in range(len(mids)) :
    if m[i] == m[i+1] :
        dupes.append( m[i+1] )

print 'Found ' + len(dupes) + ' duplicate messages.'

for m in dupes :
    typ, data = M.store( m[1], "+FLAGS", '(\\Deleted)')

print 'Marked ' + len(dupes) + ' for deletion.'

typ, data = M.expunge()

print 'Expunged ' + len(data.split()) + ' messages.'
Duplicates begone!

It's a little annoying that imaplib doesn't have a friendly wrapper function for marking messages for deletion, but M.store( m[1], "+FLAGS", '(\\Deleted)') does the job just fine.

Going to China

Posted by Russell on April 14, 2008 at 5:02 a.m.

I'm going to China in about a week to visit Mimi. I'll be in Beijing for about twelve days, and I'll have about $500 to spend. What should I do?

Vort.org now running on Django

Posted by Russell on March 27, 2008 at 12:53 a.m.
For the last couple of years, I've been running Typo, a Ruby on Rails blogging tool. It was nice, but there were a few persistent problems I encountered :
  • It was sloooooow. Nothing I did seemed to get it to run faster, even with carefully tuned caching.
  • It was unstable. Typo would run happily for months, and then mysteriously explode. This usually happened while I was traveling, or busy with something more important.
  • It was difficult to fix. Usually, when Typo would come down, it took a few days of research and pestering people to figure out why.
  • The database migrations between versions were awful. You'll notice that the first year of posts don't have any tags. They were deleted by a bad migration. I have backups, but merging them back in is nightmarish.
A lot of the problems I experienced are with older versions of Typo. They've definitely gotten better over the years. But there is one big reason I'm abandoning Typo; I don't want to code in Ruby. I do most of my coding in python. I like python. I seems silly not to use the knowledge I have from doing computational physics in python.

I have used Blogmaker for most of the main elements on my site, but with a fair bit of hacking to make it do more of what I want. I also wrote a Typo-to-Django import utility, if anyone is interested. The URLs are slightly different, so I'm going to watch the 404s for a few days.

Converting an IBM X40 to Flash

Posted by Russell on February 21, 2008 at 7:02 p.m.
The Hitachi 1.8" hard drive in the IBM X40 is probably the worst data storage product I've ever used. It is expensive, excruciatingly slow, irritatingly loud, and non-standard. There are basically no options for replacement except to just buy another one. And, as I discovered to my sorrow, it is also fragile and unreliable. So, I decided to replace it with a Compact Flash card.

You may have heard something about Solid State Drives (SSDs), such as the one available as an option for Apple's MacBook Air. You can think of this project as sort of a poor-man's version of these products.

While most CF drives are relatively small and expensive, there are a few products that seem to sacrifice speed for capacity. This may seem sub-optimal, but the drive it will be replacing is astonishingly slow to begin with. According to hdparm, it can do buffered reads at 18 MB/sec, but in practice that seems pretty optimistic.

If I understand correctly, the Compact Flash interconnect standard is basically a subset of IDE. So, you just need a little passive adapter board, and you can plug a CF card directly into an IDE port. I used a D44MIDECF adapter card from Addonics. At $20, it's a little overpriced. There are no active components, and the board contains only the CF plug, the 44 pin IDE pinout, a jumper, a surface mount resistor, a surface mount capacitor, and a surface mount LED. On the other hand, it is something of a specialty part, so I suppose I should be happy that they bothered to sell it to me at all. For the CF card, I found this monster on NewEgg.

The X40 doesn't have removable media (other than the SD/MMC reader). I've always hated fiddling around with boot floppies and installers anyway. Supposedly, Debian has gotten their installer in better shape since I last played with it. That was more than five years ago. I just skipped that whole process, and built out a minimal Debian install by hand. I popped the CF disk into my SanDisk USB Flash reader, and did the following :

sudo fdisk /dev/sdc 
   # created a 31 GB primary partition tagged as Linux [id 83]
   # and a 1 GB primary partition tagged as Linux Swap [id 82]
sudo mkfs.ext3 /dev/sdc1
sudo mkswap /dev/sdc2
sudo mount /dev/sdc1 /mnt/flash
sudo debootstrap sid /mnt/flash/ http://linux.csua.berkeley.edu/debian
sudo chroot /mnt/flash
vi /etc/apt/sources.list
apt-get update
apt-get dist-upgrade
apt-get install linux-image-2.6.24-1-686 grub sudo 
mkdir /boot/grub
update-grub
vim /boot/grub/menu.lst
exit
sudo grub-install --root-directory=/mnt/flash --recheck /dev/sdc
Then, pop the CF card in its little adapter board into the drive bay, and boot. Hooray! Here is how hdparm identifies the CF disk :
/dev/hda:

 Model=, FwRev=20070912, SerialNo=CF CARD 000040D9
 Config={ HardSect NotMFM Fixed DTR>10Mbs }
 RawCHS=16383/15/63, TrkSize=0, SectSize=576, ECCbytes=4
 BuffType=DualPort, BuffSize=1kB, MaxMultSect=1, MultSect=off
 CurCHS=16383/15/63, CurSects=15481935, LBA=yes, LBAsects=63438848
 IORDY=no, tPIO={min:120,w/IORDY:120}, tDMA={min:120,rec:120}
 PIO modes:  pio0 pio1 pio2 pio3 pio4 
 DMA modes:  mdma0 mdma1 *mdma2 
 AdvancedPM=no

 * signifies the current active mode
The default IDE settings for the CF drive result in very slow performance, so some tuning is in order. I edited /etc/hdparm.conf accordingly :
/dev/hda {
        write_cache = on
        io32_support = 3
        dma = on
        lookahead = on
        interrupt_unmask = on
}
Here is the output of the script :
Setting parameters of disc:
/dev/hda:
 setting 32-bit IO_support flag to 3
 setting unmaskirq to 1 (on)
 setting using_dma to 1 (on)
 setting drive read-lookahead to 1 (on)
 setting drive write-caching to 1 (on)
 IO_support    =  3 (32-bit w/sync)
 unmaskirq     =  1 (on)
 using_dma     =  1 (on)
 look-ahead    = not supported
 write-caching = not supported
  /dev/hda.
The result is actually a little faster than the Hitachi hard drive :
sudo hdparm -Tt /dev/hda

/dev/hda:
 Timing cached reads:   1474 MB in  2.00 seconds = 737.30 MB/sec
 Timing buffered disk reads:   44 MB in  3.13 seconds =  14.06 MB/sec
So far, I'm pretty happy.

Waterboarding

Posted by Russell on February 12, 2008 at 4:03 a.m.
Now that it looks like the Pentagon is finally ready to use the Military Comissions Act, I think it's important that we all get something straight. Waterboarding is not "simulated drowning." It does not "mimic the sensation of drowning." It is actual drowning. Just as you can choke on a under-chewed wad of burger meat without actually choking death, you can drown for a couple of minutes without expiring. It is absolutely possible to kill someone in the process of waterboarding them.

So yeah. It's torture. And we did that to some guy as part of an investigation by the duely constituted authorities. America is in the torture business, and it's official. The only question now is what sort of paperwork has to be filed for torture-induced confessions to be admissible in the tribunals, which by the way, are entirely under the direction of the executive branch.

The only question is this: Can we be as good at show trials as the Soviet Union? It's a challange, but I have great faith that us dilligent, hardworking can-do Americans can put together the most justice-y show trial yet.

Primary 2008

Posted by Russell on February 05, 2008 at 1:50 p.m.
Here's my ballot for the 2008 California Democratic primary. As you can see, I voted for Obama. I hope you will vote for whoever you feel would be the best nominee, but some people may be intersted to hear my reasons for voting as I have.

Why I Won't Vote for Hillary

Hillary's campaign has focused relentlessly on one theme: Experience. She's been fighting for middle-class Americans for a long time, particularly on the subject of health care. People who don't like her have tried to minimize Hillary's role in the Clinton White House; they evidently don't remember the 1990s. The trouble is not that I don't think she has the experience, it's that I'm not particularly impressed by her accomplishments.

That's a pretty sweeping assertion, so let me offer the most important example of what I am talking about. The touchstone moment of Hillary Clinton's tenure in the White House was the introduction of the health care package. At the time, it was clear that health care was in crisis, and the plan assembled by the Clinton White House under Hillary's supervision probably would have more-or-less ended the crisis. I'm not going to claim that it would have been a great system, or that it was a wonderful piece of legislation, but it was clearly a bold step in the right direction. Unfortunately, the bill failed, and it failed so spectacularly that it hobbled Bill Clinton's domestic agenda even after his successful reelection.

Why did it fail? It failed for a lot of reasons, but here are the ones that stick in my mind :

  • It was a gigantic piece of legislation, more than a thousand pages of dense legal jargon. I still remember the news clips of Congressional aides setting out copies of the bill on overloaded, buckling folding tables. There was no hope whatsoever that an ordinary person, even a very motivated one, could have learned enough about the bill to understand it on its merits.
  • The bill was produced in secret. The Association of American Physicians and Surgeons even went as far as to sue the Health Care Task Force to find out what was happening in the closed meetings. They were drafting legislation that would change the whole health care system, and they shut out the doctors. Dumb, dumb, dumb.
  • The plan itself was a hideous chimera; the idea was to take the scenario under which most Americans obtain health care coverage (i.e., from their employer), make it mandatory. Then, there was a system of price controls, and various other administrative thingamajigs... In short, it lacked any kind of unity of vision that would have allowed the Clintons to articulate how it was supposed to work.
  • The Task Force deliberated for a very long time to excrete this gorgon of a proposal, and by the time it was out in the open, the initial enthusiasm and excitement had evaporated. The bill's opponents had a nice, long time to organize their attack. The attack went off like clockwork, and Newt and his cronies rode the momentum of this attack into the 1994 elections and seized control of Congress. The Clinton's didn't just loose the health care bill, they lost every bill that could have been promulgated to a Democratic Congress.
Universal health care is a pretty grand endeavor. You'd have to look at the Social Security Act to find a piece of legislation with a similar breadth and scope, so let's take a peek at the Social Security Act of 1935. It represented a historic change in the relationship between citizens and government, but the legislation is only a few dozen pages long. It doesn't take long to read, and an ordinary person can pretty much follow what most of the bill does.

The original act has been updated several times since the program was created, but the original legislation completely captured the theory, practice and most of the essential features of the program. It was fairly simple, it was astonishingly efficient (even before computers), and it works.

Hillary's health care bill didn't fail because the nasty Republicans killed it. It failed because it was a murky tangle of legal spaghetti-code constructed in secret under dubious circumstances and championed by a callous, tardy and tone-deaf technocrat.

Hillary claims that she's learned from her mistakes. On a personal level, I'm more than happy to forgive her. I think she made an earnest effort to do something good for a lot of people. However, the fact remains that we've seen Hillary spearhead a major legislative effort, and she did just about the worst job you could possibly imagine.

There are a lot of people who are very excited about the prospect of a female president. I think it would be pretty great, actually. On the other hand, she is running for president. You don't put someone in that office because you like them and think they deserve your loyalty. You put them in that office because you want them to do a good job, period. The presidency is not a reward; it is a duty. It should be given to person best able to peform that duty, and Hillary has an established record of arrogance and poor decisions.

Women have fought for a long time to be taken seriously in the workplace, in academia, and in politics. I take Hillary seriously, and I seriously don't want her to be president. She clearly has the brains and the grit to be president, but then again, I don't think she's particularly unique among women in that regard. There are millions of women who could competently serve in the capacity of President of the United States. There are women out there doing much harder jobs.

The Clinton campaign mantra is that Hillary is experienced. Yep, she certainly has lots of experience fighting for good, worthy things. On the other hand, she also has a conspicuously inauspicious track record when it comes to accomplishing these good, worthy things. She and her husband presided over the Democratic Party's most devastating legislative failure of the 20th century. I don't see why we, as voters, should reward failure.

Since then, Hillary has managed to help precipitate a number of other spectacular legislative failures :

  • Voted to authorize the Iraq war
  • Voted for the PATRIOT act (twice)
  • Voted to confirm John Roberts
On the Other hand, we've got Barack Obama. Mr. Obama might not have quite as impressive a resume as Mrs. Clinton, but
  1. he is nevertheless an astonishingly accomplished individual and
  2. he has never done anything to wreck the Democratic Party.
Both Obama and Clinton are clearly competent to hold the office -- especially in contrast with its current occupant. Mr. Obama is more charismatic, though I thik more has been made of this point than it deserves. The reason I am voting for him is that of the candidates on the ballot, he is the one with the best record of good decision making. I don't agree with everything Mr. Obama says -- I emphatically agree with Paul Krugman on the topic of mandates -- but I think Mr. Obama is the most likely candidate to actually deliver a health care package. Mr. and Mrs. Clinton had their chance, and they blew it.

The most prolific grocery shopper

Posted by Russell on January 24, 2008 at 4:47 a.m.
Random discovery of the day : If you should happen to find yourself at the grocery store without a membership fob, or if you don't want to sign up for a membership, you can always use the phone number from the Tommy Tutone song 867-5309 (Jenny). Pretty much any area code will work.

The Clinton Puzzle

Posted by Russell on December 28, 2007 at 7:09 p.m.
A friend of mine has asked if I can explain why Bill Clinton enjoyed, and continues to enjoy, relatively high popularity despite the troubles he faced in office. Obviously, one can only speculate about workings of another's mind, but in this case I think it may be possible to speculate with some measure of confidence.

The first possible explanation is that there are simply more Democrats than Republicans.

However, this doesn't really explain very much by itself. The glib talk-show explanation of Bill Clinton's popularity is that the economy was good during the Clinton years, ergo Clinton was popular. End of story.

Of course, the president does not have much direct influence on the health of the broader economy, and it is not unreasonable to suppose that most Americans who fondly remember Mr. Clinton's tenure are aware of this. A more nuanced explanation is required.

It will probably come as no surprise that I have my own theory. We are, after all, speculating on the thoughts and feelings of millions of total strangers, so my theory is probably as good as any, or perhaps at best slightly more plausible. At least it does not suffer from the obvious bogosity of the it-was-a-good-economy theory. Since theories are supposed to have names, I will name my theory Popularity Due to Reduced Rate of Disaster.

The theory goes like this. While the president does not have very much influence over the immediate overall health of the economy, they can exercise a large amount of influence over specific aspects of it. Particularly, the White House can be enormously effective at wrecking things. You don't need thermodynamics to tell you that it is easier to make a mess than to clean one up.

So, why is Bill Clinton relatively popular, and George W. Bush so unpopular? If you look for explanations in ideas and politics, you might be able to formulate some sort of explanation based on how much Americans tend to agree with the thinking of the current and former occupant of the White House. This sort of analysis is the bread and butter of TV pundits. Happily, most Americans don't think like the gasbags on TV, and so the ideological analysis offered there is very likely wrong.

I think it is more reasonable to suppose that Americans draw conclusions from the evidence that they encounter in their own lives, and have a mostly casual or academic interest in aggregate effects like GNP growth or the nominal inflation rate. This is probably why so many Americans think we are in a recession even though the GNP is growing: If you're working hard but struggling financially, then the economy sucks, and you're not likely to feel otherwise upon hearing that GNP is growing and the nominal rate of inflation is low.

So, when a president wrecks part of the economy, it may not register significantly in macroeconomic diagnostics, but it may have a big impact on how large numbers of individual people feel. I think that this is probably the most plausible model for popular opinion, at least as a first-order-approximation. A person may be ideologically inclined to agree with a president, but if that president does something that directly harms that person, I don't think the ideological agreement matters very much.

Looking back on the Clinton presidency, it is difficult to point to anything remarkably wonderful that he did, especially when set alongside other multi-term 20th century Democratic presidents (e.g., FDR). But perhaps more importantly, it is also difficult to point to anything remarkably bad, either. The worst thing Mr. Clinton did, most people agree, was have "sexual relations" with a consenting adult, and then lied about it. Sure, it was sort of embarrassing, but it had no impact whatsoever on any American, save for the dozen or so people with a personal stake in the matter. Americans came to the sensible conclusion that it wasn't really any of their business and wasn't really very important, and so the dual impeachment efforts in Congress and in the media were spectacularly unpopular.

When Mr. Clinton was still in office, the friend who posed this question remarked that the aspect of the Lewinsky incident that bothered him most was that Mr. Clinton's brief affair happened "on the public dime" and on public property. These are legitimate points, but one should keep in mind that the man was working sixty to eighty hours a week. Even if we deduct the time wasted on the affair, the public still got a fantastic bargain in terms of dollars paid per hour of presidential work, especially when contrasted with Mr. Bush's short work week and frequent, lengthy vacations. Of course the celebrated liaison happened in the Oval Office; Bill Clinton worked longer hours than a galley slave.

As far as practical impacts on individual lives, Mr. Clinton was clearly not a very bad president. In some moderately important ways, he managed to do some real good, but that probably isn't why he's popular. The real reason, I think, is the sharp contrast with the presidents before and after. George W. Bush has managed to wreck an extraordinary number of things. For example cities New Orleans and Biloxi, habeas corpus, the first, second, fourth, firth, sixth, seventh, eighth, ninth and tenth amendments to the Constitution, America's international reputation, the nation of Iraq, the World Bank, the Department of Justice, an so on. While Mr. Bush has not actually destroyed any of these things, and I think they each will eventually be rebuilt, the damage done nevertheless is real. It has had real, widespread impacts on the lives of ordinary Americans.

Rather than speaking generally about these things, I think it would be more illustrative to delve into three anecdotes that I think are representative of the sort of damage that happened before and after Mr. Clinton's presidency. Each of these events has caused substantial material harm to individual Americans.

Skid Row

Since I live in Los Angeles, I am practically compelled to mention the death-blow Ronald Reagan dealt to America's the mental health care system. As governor of California, he called for the firing of 3700 mental health employees from the Department of Mental Hygiene in 1969. The California legislature reduced the layoffs to 2600 employees and began construction of new treatment centers to replace the old-fashioned residential hospitals that were to be closed. In the resulting departmental turmoil, tens of thousands of very sick people were literally dumped onto the streets of California's cities. Most of them stayed on the streets. As the Vietnam War chewed through the draft-eligible population in the following years, a disproportionate number of these new mentally ill homeless were veterans suffering from what we would now call PTSD.

To give you an idea of why this screw-up has had such permanent consequences, you have to remember the time period in which all of this was happening. This was the early 1970s, a period of weak economic growth extremely high inflation. It was very hard on middle class families. If you were a discharged mental patient or a veteran with brain trauma, it was simply impossible to get by. The network of treatment centers has turned out to be almost completely impotent.

When Reagan became president, he duplicated these policies on a national scale. Mentally ill people flooded into city centers across the country. Many of these cities are lethally cold in the winter months, so many mental hospitals and cities evidently used the last dribbles of federal money to buy one-way train tickets for their patients. They sent them to the one city that everyone knew was nice and warm in the wintertime, and already had a big enough homeless population that no one would notice a few more: Los Angeles. If you look at the distribution of LA's homeless population, it is still clustered near the rail terminus.

Before Reagan, Los Angeles didn't have a very significant homeless population. Today, it has a permanently homeless population of 82,000 people, and at some point during the year, and additional 254,000 Los Angeles residents are homeless for some period of time.

The evence is even more offensive upon revisiting the reason it was carried out. The mental hospitals were shut down because Reagan believed that they were inefficient, and that it would be simpler to scrap the system and build a new one than to attempt reforms. All of this human misery was for the sake of speeding up the realization of a relatively insignificant cost savings.

Stranded at the Airport

My second example, again from Reagan, is the Air Traffic Control system. The Professional Air Traffic Controllers Organization went on strike to protest long hours, low pay and unsafe working conditions. Let me repeat that last one. The air traffic controllers went on strike to protest unsafe working conditions. Not unsafe for themselves, but unsafe for the traveling public. It is the only example that I know of where a trade union has gone on strike for the sake of public safety. Reagan ordered them back to work, and when they refused, he fired them en mass, and banned them from government service forever.

The fallout of Reagan's decision has left an indelible mark on America's transportation system. The positions left open by the fired air traffic controllers were filled by managers, non-union controllers, and temps. To decrease the likelihood of accidents, the FAA was forced to enlarge the minimum safety envelopes around aircraft. With low wages, long hours, ancient equipment (which hasn't been upgraded since the 1960s), poor benefits and terrible morale, it's been virtually impossible to hire new air traffic controllers. So, the conditions that triggered the strike in the first place have actually gotten worse. Reagan's purge of air traffic controllers drastically reduced the safety and the throughput capacity of the entire civil aviation system.

In some very busy airports, this throughput capacity reduction is substantial. Nearly all airport delays can be ultimately attributed to congestion at a handful of very busy airports. This congestion is a consequence of the larger safety envelopes required by the FAA to allow them to do without the 11,000 highly-trained professionals that it can neither replace nor re-hire. So, next time you're stuck sitting on the tarmac or at the gate, you can thank Ronald Reagan for putting union-busting ahead of public safety and the operational effectiveness of the FAA.

It's worth noting that both the Teamsters and PATCO endorsed Reagan in 1980.

Backdating

The last example I will give is somewhat personal and esoteric, but it is perhaps the most important. Over the last three years, many companies have been caught doing something called option backdating. The scheme works like this. An option is an agreement with the issuer of a security -- in this case, stock certificates issued by the board of directors of a company -- to either buy or sell the security at a particular price. Executive compensation packages often contain a basket of options at various prices. Usually, these options are held in escrow until a specified date, at which point they are released from escrow. The recipient may the "exercise" the option, which in this case means either buying or selling the security at the agreed upon price.

In the case of stock options, boards usually issue options based not on a price, but rather the at a price on a particular date. The scandal that has been swirling around a number of companies, including high-fliers like Apple, is that they issued stock options to their executives that had price-point dates before their issue dates. An option is supposed to be a security whose value is based on the price difference between now some point in the future. This is why options are sometimes called "futures." However, if you issue an option whose value is based on the difference in price between the price now and some point in the past, then you you know exactly how much the option is worth. In other words, it's not an option at all; it's cash.

What Apple did, and what hundreds of other companies did between 2002 and 2006, was issue these "backdated" options to their executives. Each instance of options backdating constitutes three separate acts of fraud :

  1. It allows the company to directly pay their executives billions of dollars in cash, but expense the associated costs as operating overhead instead of payroll, thus hiding the actual impact of executive compensation from investors.
  2. It allows the companies to avoid paying payroll taxes on this money, depriving Social Security and Medicare/Medicaid of billions of dollars.
  3. It allows the executives themselves to declare the money thus received as capital gains instead of income, on which they pay 22% instead of 46%.

The companies who were caught doing this were finally asked to stop sometime last year. Insofar as I can tell, there has been no substantial punishment for options backdating yet.

I did not really appreciate the magnitude of this scandal until I talked about it with my father, who has extensive experience as an entrepreneur and has served on the boards of several companies. My father started a company called Teradata (NYSE: TDC). Teradata makes database computers.

My father once explained to me that there were only two entities that posed a serious threat to his company: IBM, and the Securities and Exchange Commission. Teradata went after IBM's main business, courting some of IBM's most lucrative customers. When the company was still operating out of a grubby little building near the LA airport, they went toe-to-toe with IBM in the marketplace, and they prospered. My father was very worried that IBM would do something illegal to destroy his company, but fortunately, IBM played fair.

As scary as it was duking it out with the largest technology company on Earth, what really scared my father was the Securities and Exchange Commission. He was absolutely terrified that a there would be some sort of mistake in their accounting, or in their public filings, or in their communications with investors, that would bring down the wrath of the SEC. As soon as Teradata was incorporated, he made sure that he had the best accountants and the best lawyers he could possibly find, and he demanded absolute perfection from them. My father loathes accounting, but he spent more time checking the ledgers than on the engineering of the computer that he himself had invented. That is how scared he was of the SEC.

That is how scared everyone was of the SEC in those days. It was assumed that even a small error in the corporate accounting would lead immediately to the destruction of the company and the end of the careers of everyone involved.

When I was much younger, I once complained that it was unfair for the SEC to impose such stiff penalties. My father responded angrily, "No, it's not unfair. Teradata is made out of other people's money." Even while the ax was hanging over his own neck, my father strongly supported this strict regulation.

When Teradata was founded, no one would have dared something as shady as options backdating. They would have been ripped to shreds. So, why did it happen? Simple. George W. Bush nerfed the SEC. Companies know that America's financial cops don't have any bullets.

When you look at the credit crunch, the looming subprime disaster, and the wave of mortgage foreclosures crashing down on America's middle class, it shouldn't be any surprise how it happened.

Gamesmanship or statecraft?

Returning to the question at hand, why is it that people like Bill Clinton? That's easy. He didn't wreck anything. He appointed mostly competent bureaucrats to lead federal agencies. The ones that weren't competent got fired. He understood that the president's job is to make the government work, and he logged eight years of eighty hour weeks to make sure that it did.

His ideology was not neither inspired nor inspiring, but people like him anyway. This was the great puzzle that the conservatives who opposed him have never figured out. Newt Gingrich and Tom DeLay believed that politics is all about ideas, and as far as campaigns are concerned, they were right. However, good government is not about ideas. It is about duty, service and implementation. Government doesn't run on ideas, it runs on deeds. In that respect, government and politics are very different activities.

Bill Clinton is popular because he was pretty good at government. Newt Gingrich, Tom DeLay, George Bush and now the whole Republican Party are deeply unpopular because, while they are exceptionally good at politics, they are miserable failures in government. As long as Republicans continue to confuse politics and government, they will remain puzzled by Bill Clinton's enduring popularity.

Almost... done...

Posted by Russell on December 20, 2007 at 8:20 p.m.
I took the General GRE yesterday, and two of my three recommenders have uploaded their letters. I was sure that I had bombed the quantitative section, so I was flabbergasted to see my score at the end was rather excellent. Evidently, they really do slip experimental questions into the test that they don't score. I really appreciate the instant score report -- it saved me from two weeks of misery.

Now I just have to track down my undergrad ID number to get Northeastern to cough up my transcripts. It's astonishing how much energy this process takes, but the hard parts are done.

The carbon cutting game

Posted by Russell on December 18, 2007 at 8:53 a.m.
I was looking for something to do while Mimi was taking a nap today, and I remembered that the Energy Information Administration has tons and tons of cool data on their web site. It's more fun than video games.

So, I decided to play a little game: Let's pretend that America has just ratified a treaty that obligates us to cut our CO2 emissions by, say, 50%. How do we do it?

First, let's see how our emissions break down by economic sector :

Since about 1978, emissions from the industrial sector have been fairly flat. Meanwhile, transportation has been exploding, and overtook industrial emissions right around the end of the Clinton administration. Commercial and residential emissions have been growing at a steady clip, with residential emissions leading the way.

First, let's look at the biggest, fastest growing culprit, the transport sector.

No surprises here. Petroleum, mostly gasoline, makes up the overwhelming majority of emissions, with natural gas just barely registering. The single most effective measure we can take to cut emissions, then, is to cut petroleum consumption in the transportation sector.

This is going to be difficult. The trend has been an inexorable rise for more than half a century, and probably longer. Even the oil shocks of the 1970s don't look very impressive on the 50-year scale. In fact, in the decade prior to the shocks, there was a rise in the rate of emissions (and thus consumption), and the shock resulted in a regression to the previous trend. So, we're going to need more than just improved fuel economy. We're going to need new technology. Most importantly, we're going to have to get people to stop driving so much.

This is a tall order; if we want people to drive less, we need to uproot the automobile fetish that our country has developed. This will require a big mobilization of cultural assets. Right now, people will sacrifice a great deal of money, time, space, convenience and health to own a car. This preference has to be reversed. Culturally, we need to find a way to make car divestiture a desirable achievement. It has to be cool not to have a car. Here is an area where entertainment can play a positive role. For three generations, it's been the opposite, with movies and television fetishizing car culture from the very beginning.

We need movies and TV shows that exploit the coolness of riding the train, or walking to work, or riding a bicycle. This shouldn't be difficult. Good entertainment is all about human interaction, but the automobile is the most isolating mode of transportation possible. If you want to write about people, then trains, buses and bicycles are fertile venues, while cars are not. If we've got TV shows that revolve around crimelab investigations and people with magic and superpoweres, why not a TV show about bus drivers? There are a hundred angles you could take on that idea; it could be a noir drama, or it could have a supernatural element, or it could be a crime show. You could set it during the Montgomery Bus Boycott and make it a historical drama. You could set it during and after 1929, and make it a period piece.

Here are three policy initiatives that could get things moving in the right direction. First, all cities with public transportation have registered trademarks for their systems. The federal government could create a fund that would pay for product placement of these public transport "brands" in movies and TV. The more positive the circumstances of the placement, the larger the bonus.

Second, attack consumption directly. Raise fleetwide fuel economy standards. Raise taxes on gasoline and diesel. Go after really conspicuous consumption with direct measures; refuse to certify new Hummers, Ferraris, and Vipers as road-worthy. Give people tickets for driving aggressively.

Third, fix Amtrak. Create an endowment to support its operation and expansion so that it won't be at the whim of Congressional funding. Fund the endowment with fuel taxes, tolls on interstate freeways, and fines levied on the airlines for violating the Passenger Bill of Rights. The Atlantic and Pacific coastal cities should have rail service like France's TGV -- 200 mile per hour express trains with reasonably priced coach tickets.

Next, let's have a look at the industrial sector.

The clearest trends are volatile but stagnant conditions in petroleum and natural gas emissions while coal emissions crash and electrical emissions soar. Looking at the beautifully anticorrelated trends in coal and electricity emissions, I suspect something fishy is going on here. Let's have a look at electricity generation.

Ah ha! The industrial sector is outsourcing its coal burning to the electricity generators, who are burning coal like there's no tomorrow, if you'll pardon the gallows humor. Emissions from electricity generation are actually somewhat higher than for transportation, though they are on the same order. However, the trend in emissions from coal is actually significantly steeper than for petroleum use in the transport sector.

The coal explosion in the electricity generating sector is responsible for the rise in emissions in other sectors as well. For example, the commercial sector :

The emissions due to electricity in the commercial sector notch almost perfectly into the trend for emissions from coal. The residential sector doesn't notch in quite as clearly, but the trend holds.

It's the same trend across all non-transport sectors. We see the stagnation of petroleum and natural gas emissions while coal vanishes and emissions due to electricity explode, following the trend of coal in the electricity sector.

This makes it very clear. The absolute emissions and the growth of emissions in all non-transport sectors of the economy are due to burning coal for electricity. You'd expect coal to make up most of our electric generating capacity, wouldn't you?

Nope. Coal is responsible for most of the emissions from electricity generation, but only about a third of the electricity. We get about twice as much electricity from natural gas, but it's responsible for a relatively small fraction of our emissions.

Of course, this should be fairly obvious from the chemistry of coal and methane: Coal is more than 90% unsaturated carbon, consisting of long chains of double and triple bonded carbon atoms and aromatic cyclic structures, mixed with amorphous graphite and some volatile hydrocarbons, while disassociated methane is four-fifths hydrogen by volume. Coal is mostly carbon, and natural gas is mostly hydrogen.

The upshot is this; if we can wring about 30% worth of efficiency improvements from the non-transport sectors of the economy, we can do away with our coal plants altogether. This will cut the emissions of the industrial sector by about 40%, and 65% and 75% for the residential and commercial sectors, respectively.

Alternatively, we could aim for about a 15% efficiency savings, and double our nuclear capacity, or increase our renewable capacity by about fivefold. Whatever policy is chosen, it is abundantly clear that it must result in the eradication of coal from our electric generating portfolio. Even petroleum and natural gas are better.

Our prospects in the non-transport sectors are actually pretty good compared to the transport sector. We have a mix of different technologies, none of which make up a plurality of our portfolio, and most of the emissions can be attributed to the second-largest minority component. We have 1,493 coal plants which have an aggregate capacity of 335 gigawatts. That is an equivalent capacity to about 55,833 wind turbines. That many turbines would cost about $446 billion to procure and install. For comparison, the direct cost of the Iraq war has been about $478 billion, as of today.

Technically speaking, a 50% reduction in CO2 emissions is not far-fetched. It's well within our ability to build and to finance. A 20% reduction could probably happen without any noticeable drag on our economy whatsoever -- we just need to provide good incentives for saving electricity, and preferentially shut down coal plants.

Don't be afraid of mandatory carbon caps, even aggressive ones. If we can blow half a trillion dollars on a pointless war that gains us no advantage whatsoever, we can afford to fix our emissions problem. Maybe not both at the same time, but we'll be leaving Iraq soon anyway.

Science Debate 2008

Posted by Russell on December 12, 2007 at 6:32 p.m.
There is a group that is putting together a presidential debate specifically focused on science. I think the idea is that it would come after the primaries, so it would be among nominated candidates. How cool would this be?
Moderator : Senator, on the issue of dark matter, you have...

Clinton : Read my lips: No. New. Particles.

Moderator : I see. Mr. Huckabee, what is your position on dark matter? Do you agree with the Senator's assertion that it is baryonic in nature?

Huckabee : No, no I do not. If it were baryonic, it would interact strongly with light, and we would be able to see it. Then it wouldn't be dark matter, would it? No, I believe that we are facing something new and terrible; an abomination to those of us who actually obey the Pauli Exclusion Principle. That is why I have a four-point-plan for eliminating the scourge of dark matter from the universe.

Clinton : This is exactly the sort of misplaced priorities that I've been talking about. How can we be talking about non-baryonic dark matter when we don't even know the properties of the Higgs? What if there is no Higgs boson, and the whole supersymmetric model goes out the window? What if the Higgs turns out to have a mass in the range of only a few TeV, and these non-baryonic particles aren't heavy enough to explain the non-observable mass in the universe? Or what if the Higgs is hundreds of TeV, and the supersymmetric particles are too rare? We don't have the answers to these questions. This whole business of non-baryonic dark matter is really putting the cart before the horse.

Furthermore, I really must object to my opponent's fermion-centric position. While it is indeed true that Americans are mostly made out of fermions, we would not be the same country without the patriotism and hard work of bosons. Who would mediate the electroweak force if it weren't for the photon? Who would bind together our nucleons without the meson? My opponent is, at this very moment, harboring gluons in every proton and neutron in his body.

Seriously, though, whoever wins the nominations, I would just love see this sort of debate.

Peadal power

Posted by Russell on December 04, 2007 at 4:26 a.m.
When you're at the gym, do you ever watch all the spinning wheels and slowly reciprocating weights and think about what a waste it is that all of that effort isn't captured and put to work generating electricity? Isn't that a lot of energy?

My usual workout includes a ten mile bike ride, which I usually complete in about 45 minutes with heavy resistance. According to the machine at my gym, I burn about 500 calories, or 2.1 megajoules, in the process. I'm going to assume the machine means kilogram calories, which is what you see on food labels.

Evidently, I'm putting out a bit more than three quarters of a kilowatt. That's a bit more than one horsepower, which is 745.7 watts. This is a bit surprising -- that's not too far shy of what Wikipedia says you'd expect for the first six seconds of a cycle sprint (900 watts). A professional cyclist can hit about two kilowatts during a sprint. So, 775 watts sustained over 45 minutes is not too shabby.

If they had bothered to wire my exercise bike into the grid, LA Fitness would have obtained 581 watt-hours from my efforts. In Pasadena, we pay $0.15 per kilowatt-hour, so I managed to produce a little less than a dime's worth of electricity. If a hundred people did the same workout, which is roughly what I'd expect over the course of a day, we would together generate $8.72. The gym could save that much by switching off the TVs when no one is watching, or turning down the music a little. The electricity you can generate on an exercise bicycle isn't worth the wires that would carry it.

According to the Department of Energy, the average American household uses about 29.2 kilowatt-hours of electricity per day, so you'd have to pedal at the sprinter's pace of 1216 watts, all day, every day, just to keep up with your household use.

My 2.1 megajoules of peadaling is actually a lot of energy. What astonishes me is that even this rather large amount of energy is worth so little.

Update : My friend Chris points out that the bike at the gym is probably reporting some kind of estimate total power, including power dissipated as heat, that it extrapolates from the work you put into the mechanism. He suggests that around 20-25% of the calories you burn are available as work, so that means I am putting somewhere around 155 to 194 watts into the bike. This probably has an error of 50% or worse, since the bike is extrapolating the total power from the mechanical power, and then I'm extrapolating back to the mechanical power from the result. The actual electricity one could generate is more like $0.02 worth.

Killing the watts

Posted by Russell on November 25, 2007 at 11:11 p.m.
My mom has been interested in energy conservation for a long time. She's managed to take a pretty considerable bite out of her electricity and gas usage by taking some very simple steps. Below, I've plotted her energy use over the last couple of years. I was only able to find a handful of bills, but it's enough to see the trend. The first big reduction is just from minor adjustments in habits -- turning the lights off when she leaves the room, and opening the blinds to use natural light in the daytime. The second big reduction is from installing compact florescent bulbs. That doesn't sound very exciting, but it cut her electricity use by 50-70%. If you've been doubting that those sorts of changes make a difference, seeing is believing.
This is, by the way, without any new appliances. She's still got a washing machine and dryer that are almost as old as me, a non-EnergyStar dishwasher, and a massive professional refrigerator that predates EnergyStar altogether.

The most obvious place to start, of course, is the refrigerator, which I estimate to be sucking down between 2.5 and 5 kwh per day. Or, at least, that's what it would have used when it was new, so it could be as much as 20% more than that. To maintain that nice downward trend, I've advised her to trade up to a Sun Frost RF16, which absolutely crushes the competition, using less than half a kwh per day. The most efficient models from big brands use about three times as much. Also, they're built right here in the USA, in Arcata, California.

The cost-benefit analysis for washer, drier and dishwasher isn't quite as stark. The main reason for swapping those out are to save water and gas. For gas, the easiest savings can be had by replacing the water heater, and she's already got an awesome tankless water heater. For water, toilets and outdoor watering are the main culprits. She has a couple of dual-flush toilets on order, and a there are a bunch of rain barrels staked in the driveway. They will be hooked up when the new rain gutters are installed.

When that's all done, she'll be ready to push the trend line the rest of the way down to the axes. Ultimately, solar is the way to go in southern California, but as long as panels cost a couple of dollars per watt, you'd be crazy not to do the easy stuff first. In any event, she wants to have some excess capacity in her photovoltaic system. Someday, she swears, she's going to have an electric car.

Tales of the surge

Posted by Russell on November 23, 2007 at 6:19 p.m.
Tuesday, the New York Times ran the latest in the series of bizarre articles claiming that the troop surge in Iraq is working. The premise of the article rests on perhaps the weakest justification for optimism I have ever read, anywhere.
The security improvements in most neighborhoods are real. Days now pass without a car bomb, after a high of 44 in the city in February. The number of bodies appearing on Baghdad’s streets has plummeted to about 5 a day, from as many as 35 eight months ago, and suicide bombings across Iraq fell to 16 in October, half the number of last summer and down sharply from a recent peak of 59 in March, the American military says.
Mein Gott! Days pass without a carbombing! Let us rejoice! The article parrots this sickly good news, which is the best news the chefs at the Pentagon can cook up from the year's putrid harvest. Need I remind you that the New York Times is once again reporting Bush administration numbers as if they were fact. That hasn't worked out so well for the Times in the recent past, but here they are, doing it again.

Much of the fall in violence can probably be explained by successful ethnic cleansing throughout Baghdad.

Why are they buying this pitiful, slightly-less-awful picture? Simple. They can't speak Arabic. Juan Cole offeres a more complete picture of what's going on in the region, a picture he is able to express thanks on an amazing ability called "bilingualism." Actually, Cole is fluent in Arabic, Persian and Urdu and reads some Turkish, according to his CV. Evidently, the New York Times can't be bothered to make itself aware of what is reported elsewhere. What sort of picture does Cole see in the Arabic media? It still looks like a full-blown civil war to me.

Presidential forums with awkward names

Posted by Russell on November 20, 2007 at 3:31 p.m.
On Saturday, I decided to head to the VA complex next to UCLA to watch the Global Warming & America's Energy Future Presidential Forum. I guess you could include it among the unending barrage of presidential debates we're suffering through. Having caught just enough of the last Democratic debate on CNN to ruin an otherwise enjoyable dinner, I was was pleasantly surprised that this forum turned out to be rather interesting.

The panelists asked sharp questions, but there was no attempt to "get" the candidates. There was a refreshing absence of false dichotomies, litmus tests and provocations. They just asked difficult, technical questions. For example, Edwards said that we ought to essentially ban coal, but that coal miners should not be made to bare brunt of this economic realignment because the problem is not their fault. He was asked the obvious follow-on question : That means compensation. How do we pay for it?

And then something astonishing happened. Edwards answered the question directly, and the panelists let him. He'd already explained that to reduce emissions, we need some kind of carbon tax. It's estimated that such a system would raise about 20-40 billion dollars a year, depending on the details of implementation (which is up to Congress). This block of money would be divided among three goals; remediation of environmental damage, research, and helping people in "dirty" industries get new, better jobs.

The audience was very enthusiastic throughout, but the enthusiasm crested highest on the occasions when the panelists, candidates and moderator insulted CNN, particularly Tim Russert. I guess this reflects the fact that the only thing less popular than Congress is the Media. If Wolf Blitzer had walked onto the stage, he would have been booed out of the hall. Child molesters are more popular than the Media.

The candidates don't have to use FOX or CNN as their forum. There are lots and lots of nonpartisan issue-oriented groups that would happily host debates. The questions will be less stupid, and the format won't be designed to maximize catfighting. Issue-oriented groups will listen to answers longer than 15 seconds without getting bored, assuming the candidates stay more or less on topic.

The biggest surprise, for me anyway, was that I felt a lot more confident about Hillary after hearing her speak without an idiot media stooge nipping at her heels. She made it very clear that she understands the issue of climate change, and that she understands the need for bold action. She has some specific proposals, but they aren't really unique from what Edwards proposes -- not that I fault her for that. It's pretty obvious what needs to be done, so all the serious proposals will tend to look about the same. I suppose I shouldn't be surprised, because her intelligence has never been in question.

The trouble I have with Hillary is not concern that she would make a good president. I think she would do a pretty good job. At least as good as her husband did, and probably better. She is smart and capable, and her priorities are pretty much right. The problem I have with her is that I think she would make and awful leader for the progressive movement. She represents a view -- "The perfect is the enemy of the good" she said during the forum -- that is immiscible with philosophical leadership. She would be a competent administrator. She would work hard and push for the right things. But I can't see her galvanizing a new progressive coalition. She would leave the Democratic party in the same state her husband left it; hollowed out and fractured.

The electorate is crackling with a punishing voltage of dissatisfaction, and it isn't any mystery what is pissing people off. There are very real, terrible problems facing our country. People have a whole menu of issues to be pissed off about -- climate change, our inept counterterrorism policies, income inequality, health care, a hostile international community, our diseased financial system, the trade imbalance, Iraq, and more. And Washington is doing nothing to fix this stuff. Nothing.

On one terminal, we have three hundred million Americans who like to get shit done, and on the other terminal, we have a few hundred politicians in Washington who aren't doing shit. The system has been charging up for a very, very long time. We need a president who will be a big fat wire between these two terminals. We need a way to pipe our collective dissatisfaction into Washington until its denizens either get to work or vaporize from the political scene. I can't see Hillary doing that. She is a natural insulator; her natural instincts are to mediate and compromise. That's very admirable, and in a different situation would be highly desirable. But if someone doesn't hook the terminals up, eventually the whole thing will short out and we can kiss democracy goodbye.

Maybe I'm wrong about Hillary. A lot of people are enthusiastic about her, and that's a good sign. It would be nice if she stopped undermining the progressive part of the party, and started beating up on the GOP for keeping Washington paralyzed.

Also, I think a lot of people fail to appreciate what a great thing Dennis Kucinich is doing for the party. First of all, he's not undermining the Democratic part by running in a third party, like Nader did. Second, by running boldly to the left of the pack, he is flanking the other candidates, making them harder to attack. It's safer for them to take liberal positions because they will still be moderate on any scale that includes Kucinich. This something that happens frequently in Republican primaries -- there is an unpopular fascist thug, and the other candidates look nice and moderate by defeating him. Not that Kucinich is an exact mirror of that picture. He would probably be a center-right candidate in most functioning democracies. This highlights how important it is for the Democratic party to have people like him.

Now, if we had a few actual Communists in Congress, like most democracies, then moderate liberal politicians would have lots of maneuvering room. The Democrats could hold up practically any serious proposal, and it would look conservative when contrasted with the lunatic position from the Communists. Single-payer healthcare? Look, it's better than Communism, don't you think? You don't want Communism, do you? Great, so vote for our plan.

Anyway, I'm pretty disappointed that Barak Obama didn't come to the event. It was very unfortunate.

The noble throne

Posted by Russell on November 03, 2007 at 5:52 p.m.
Something to think about next time you're sitting on the can: 2.5 billion people do not have access to a toilet.

Next time you get into a seat up/down argument with a co-inhabitant, why not settle the argument by recognizing how lucky you are to have a toilet in the first place? Donate a few bucks to the World Toilet Organization.

Protect your noodle

Posted by Russell on October 31, 2007 at 12:58 a.m.
Yesterday afternoon, my little sister was hit by a car while riding her bicycle across the University of Oklahoma campus. She suffered lacerations and abrasions to her face, lost a couple of teeth, and a number other injuries. She also has a serious concussion. She is now experiencing memory loss, disorientation, extreme nausea, and huge amount of pain.

All of this is, in a sense, good news. She was very, very lucky, given that she was not wearing a helmet. The prognosis is that she will recover completely after some unknown amount of time. My mother flew out to Oklahoma on the first available flight, and she'll be staying with Anna at least throught next week.

She is an exceptionally smart girl, and she knows perfectly well how important helmets are. When we were little, I witnessed her flip her bike and pile-drive her head into the sharp point of the curb in front of our house. She was not hurt, but her helmet nearly split in half. We still have that helmet, even thought it is ruined. The seven inch long, two inch deep gash across the crown makes it perfectly clear that Anna would have died that day, had it not been for a geeky-looking early 1990s vintage Bell helmet. The very first serious email I ever wrote was to thank Bell Sports for saving my little sister.

Now is not the time to wonder why she wasn't wearing her helmet yesterday. Maybe she lost it, or maybe she figured she was only going to ride a short distance, or maybe she didn't expect any cars on campus. We may never find out, given that she doesn't remember the accident. For now, we're focusing on when we can take her out of the hospital, and how long it will take her to recover.

I am writing this here today to ask you, dear reader, to always wear the proper safety equipment. Concussions are not funny. Shit happens. Protect your noodle.

I am going to go ahead and shamelessly plug Bell helmets. Bell has been making helmets since 1954, and they invented the modern bicycle helmet in 1975. Bell saved my little sister once, so they've got my vote for life. Buy a helmet, and make sure it is on your head whenever you so much as handle a bicycle, in case you are overpowered by a sudden uncontrollable urge to peddle around. In fact, buy two, just in case you loose one, or for variety, or for the hell of it.

If you are wondering how to make bicycling safer, you can do two things. Wear a helmet, and bicycle more :

The analysis undertaken in this study suggests that policies which lead to an increase in cycling will not increase the likelihood of cyclist crashes. From the work reported here, it seems the more cyclists there are on the roads the lower the risk that any individual cyclists will be involved in a collision. Road safety professionals concerned about reducing the likelihood of cycle crashes might consider measures that increase cycling.

Food for words

Posted by Russell on October 25, 2007 at 3:59 a.m.
Go to FreeRice and see how good your vocabulary is. Every time you answer correctly, you earn ten grains of rice for the UN World Food Programme from the site's advertisers.

I can't wait to say, "My, you look positively vermicular today!"

(via TreeHugger.)

Bus racing

Posted by Russell on October 23, 2007 at 7:14 p.m.
On my way home from UCLA today, I decided to see how fast I ride my bike from Westwood and to the terminus of the Metro Purple Line on Wilshire and Western. Particularly, I was interested to see if I could get there quicker than the 720 bus. To make it fair, I waited until there was almost no traffic for the bus to get mired in. Rush hour now lasts well into the late evening, so traffic was heavy but not jammed at 9:00 PM.

I waited for a 720 bus to pull into the station, and then took off. It was pretty much a dead heat until the Starbucks at San Vincente, and I got a couple of lucky breaks from the walk signals. I beat the bus to Western by about four minutes, completing the trip in 43 minutes without breaking a sweat. Oh, and it's mostly an uphill ride with lots of pedestrians to which one must yield.

Up in smoke

Posted by Russell on October 23, 2007 at 5:12 a.m.
The upper atmosphere was pretty think with smoke today, though I don't see any ash falling in Pasadena or near UCLA. 500,000 people have been ordered to evacuate from what may be the worst outbreak of fire in California history. A constellation of fires are burning from Santa Barbara to the US-Mexico border.

There aren't enough firefighters, and, as has been the case for a long time now, much of California's National Guard is in Iraq. The Guard that is still here is also missing a lot of vehicles and equipment, because the equipment is in Iraq now, or because it was destroyed in Iraq. The Guvonator had to order 200 guardsmen away from patrolling the US-Mexico border, and people's homes are still burning without a firefighter or a guardsman in sight.

For those readers outside of California who are chalking this up to the various "natural" disasters for which California is famous, I'd like to offer a little explanation. Southern California is a desert. Specifically, it is biotic system called chaparral. Normally, it looks sort of like this :

The land is loosely covered with scrubby sagebrush and small, knotted trees. Small clumps of grasses or wildflowers grow here and there, but mostly the surface is exposed rock. There is almost no water whatsoever. One of the peculiar features of this kind of land is that it is supposed to burn. Chaparral plants evaporate volatile oils -- turpentine -- into the air to encourage fires. This is why Chaparral smells so nice, and why it fucking burns all the time.

So, the problem is this: What kind of idiot would build a house in the middle of a place that is supposed to burn to the ground every four of five years? The answer is that it isn't the idiots, it's the assholes. The people who built those houses (and whole towns, in many cases) knew exactly what was going to happen. But they slapped the houses together and sold them to regular folks looking for a place to live. They've been doing this for a hundred years.

For the New Englanders who read this blog, think of it this way. Rivers are supposed to flood periodically, usually into special areas called floodplanes. These areas have plants and animals that are adapted to life in a place that floods from time to time. In fact, many of them would die if there weren't floods. We know all this. Nevertheless, people still build houses in floodplanes. Usually, though, the home owner isn't the one at fault. They just moved in, and then one year, their house floods, and everyone says, "You idiot, you built your house in a floodplane."

Well, chaparral is sort of the same thing. Instead of a floodplane, it's a fireplane. It's a really, really stupid place to build a house.

But of course, the homeowner didn't build anything. Usually, a gigantic multinational corporation, like KB Home, is responsible for developing the site. No, you say, no developer would knowingly build in a floodplane, or in a fireplane, or some other obviously dangerous place. Allow me to direct your attention to one of their developments in Arlington, Texas :

According to plaintiffs' attorneys, the land that KB Home developed into the Southridge Hills subdivision was once owned by the U.S. government and was part of a naval training range. Commonly known as Five Points Field, it was used as a military practice bombing range during World War II, the firm said.

The government sold the property in 1956. Lawyers said in its deed to the purchaser, the U.S. government acknowledged that the property was subject to contamination by the introduction of unexploded bombs, shells, rockets, mines and charges. The government recommended that the target impact area be restricted to "above surface" use only, the firm said.

They built homes on top of fucking bombs, and then sold them to people without telling them. So, do you think they have any qualms about selling people homes in floodplanes, chaparral, and hurricane highways?

Now, I'm not against building homes or against multinational corporations building them. However, it is worth noting that if my IBM ThinkPad exploded and burned into a cinder because the battery charging circuit was defective, no one would be shocked or surprised if I expected IBM to replace my laptop with one that doesn't explode. Houses placed in unstable locations are defective. Whoever built them should be expected to replace them with houses that aren't defective. If we held companies like KB Home to the same standards we hold Apple and IBM, then we wouldn't be evacuating 500,000 from regions that are naturally supposed to burn.

Two weeks on a folding bike

Posted by Russell on October 21, 2007 at 6:29 a.m.
Since I am now commuting to UCLA from Pasadena, I've spent a lot of time wondering how to cut down of the time, expense and misery of commuting. Most of that pondering happened while trapped somewhere on the Ventura freeway, or the perhaps on driving aimlessly around Westwood looking for a parking spot.

To that end, I've started using the Metro as much as possible. The Metro Gold Line is fantastic, and gets me from Lake Street in Pasadena to Union Station downtown in about 20 minutes (less if I catch an express). The Purple Line gets me as far as Koreatown, and this is where things start to suck. From Wilshire and Western, it's about seven miles to UCLA. During business hours, the 720 bus takes about an hour and 45 minutes to traverse this miserable stretch of urban leprosy. The worst part is Beverley Hills, which I would gleefully bulldoze if given the chance.

It's maddening. The first 22 miles of the trip take about 30-45 minutes, depending on intervals between trains. The last six and a half take three times that.

While I was riding a 720 bus packed with more people than I attended high school with, it occurred to me that 6.5 miles in 105 minutes is a little slower than four miles per hour. I could probably beat that walking on my hands.

So, I bought some new tires for my bicycle, and gave it a try. Sure enough, I passed five or six 720 busses as they sat like flatulent beached whales in the morning rush hour traffic. With all the traffic lights, it's a slow ride, but it takes about 50-60 minutes, so I'm averaging between 6.5-7.8 miles per hour. In West Los Angeles, velocities this high are known to cause Cerenkov radiation. I could go a lot faster if drivers would actually look at the road instead of staring blankly into space while driving their Range Rovers in the bike lane, parking in the crosswalk or on driving on the sidewalk to get around busses (yes, really). It would be certain death for a cyclist if all of this mayhem weren't happening at the speed one can push a loaded dumpster up a hill.

There is just one problem, though. When you're not riding it, a bicycle is miserable thing to carry. You may as well be traveling with an Alexander Calder sculpture.

So, I bought a folding bicycle :

This is a Brompton M6R. It folds up really, really tiny, and has little wheels on the bottom to roll it like a suitcase when it's folded up.

Surprisingly, the small wheels don't seem to make much of a difference with stability. The only difference, really, is that it takes a lot less torque to turn the front wheel, even at speed. This makes it feel "twitchy" at first, but the sensation goes away after about twenty seconds of riding. The Bromptons also have really strong breaks. You have to be careful not to pitch yourself over the handlebars.

Compared to my road bike, the Brompton is almost alarmingly responsive. This makes it ideal for crowded situations -- it's easy to avoid unexpected obstacles, squeeze through narrow spaces, and stop suddenly. When it's folded up, it's nice to be able to walk down the train platform without goring people with the pedals or stabbing them with the quick release levers.

The Brompton has two main disadvantages. First, it's a little on the heavy side. I didn't shell out for the titanium version, so it weighs in at 23 pounds. This turns out not to matter very much, except when lugging it up long flights of stairs. The second disadvantage is that I must answer a never-ending stream of questions about it.

I will write a more detailed review of the bicycle itself in a few weeks.

Trading the tundra for a Tundra

Posted by Russell on October 03, 2007 at 6:05 p.m.
Only a few day ago, I discovered that my wonderful Toyota Yaris probably outranks my mother's (also pretty neat) Toyota Prius in terms of lowest carbon footprint. It appears the Yaris has the smallest carbon footprint of any car available in the United States.

Unfortunately, when it comes to fuel economy standards, what Toyota gives with one hand, it takes away with the other. Thomas Friedman expounds in his op-ed today :

What I don’t get is empty-barrel politics — Michigan lawmakers year after year shielding Detroit from pressure to innovate on higher mileage standards, even though Detroit’s failure to sell more energy-efficient vehicles has clearly contributed to its brush with bankruptcy, its loss of market share to Toyota and Honda — whose fleets beat all U.S. automakers in fuel economy in 2007 — and its loss of jobs. G.M. today has 73,000 working U.A.W. members, compared with 225,000 a decade ago. Last year, Toyota overtook G.M. as the world’s biggest automaker.

Thank you, Michigan delegation! The people of Japan thank you as well.

But assisting Detroit’s suicide seems to be contagious. Everyone wants to get in on it, including Toyota. Toyota, which pioneered the industry-leading, 50-miles-per-gallon Prius hybrid, has joined with the Big Three U.S. automakers in lobbying against the tougher mileage standards in the Senate version of the draft energy bill.

This is one of the reasons it's a bad idea to allow so few companies to dominate such an important market. It virtually guarantees that even the "good guys" to get mixed up in bad business, and no approach actually taken will stand out as clearly the right one. If there were more car companies each with a smaller market share, it would be more likely that at least one of them would hit on the right mix of innovation, marketing and public policy.

Remember, Toyota also makes the unfortunately-named Tundra. Imagine yourself a future history textbook author in a time when there isn't any actual tundra left in the world. Would you pass up the opportunity to bash a company for naming a product after the ecosystem it helped erase from the Earth?

A revolution in saffron

Posted by Russell on September 26, 2007 at 4:40 a.m.
The police in Burma are firing warning shots and arresting the monks who are defying a ban on public gatherings. I was literally holding my breath listening to the BBC reporting from Rangoon.

I first studied Burma when I was a freshman in high school. Burma was the topic in policy debate that I dreaded the most; just thinking about it put me on the verge of tears. Even today, I find it utterly impossible to say anything rational about the situation there.

Much of humanity is sustained through its daily misery by the hope that evil can be defeated without resorting to evil. We all hope that somehow, someone will figure out a way.

If I believed in God, I would pray for Burma.

LED lamps from IKEA

Posted by Russell on September 25, 2007 at 6:27 a.m.
Ikea has a very nice and aptly-named LED lighting product called DIODER. It has four lamps, uses about a watt, and nicely illuminates a good-size desk.

I installed one for my mom's microscope workspace. Yes, I'll do something about the dangling wires when I have time to buy wire-ties.

How to get out of Iraq

Posted by Russell on September 25, 2007 at 6:04 a.m.
This idea has probably been floated before, but it occurs to me that there is a very simple plan for getting us out of Iraq: Hold a national referendum in Iraq on whether or not to continue the occupation. If the Iraqis tell us to get out, then we should get out. Immediately.

The Republican position seems to be that we have to stay in Iraq to protect its "young democracy," as the president described it yesterday. There could hardly be a more democratic way of settling this question. On the other hand, a referendum is almost sure to result in a resounding "Get Out."

If the Democratic Party is looking for a nice, reasonable, uncontroversial plan for getting out of Iraq, I can't see how this one could be attacked. We're ostensibly in Iraq for its own good. If we're not wanted, then we ought to withdraw. No one could call it cutting and running if we are asked to leave.

A Prisoner's Dilemma

Posted by Russell on September 15, 2007 at 11:54 p.m.
Los Angeles traffic provides fertile grounds for situations that can be modeled with the Prisoner's Dilemma. It's not difficult to guess what strategy the owners of the Toyota Land Cruiser and the Chevy Tahoe have decided to play :

I encountered these two defectors in an extremely crowded parking structure in Old Town Pasadena. This isn't just antisocial behavior. The owners of these two titanic vehicles are also breaking the clearly written rules.

It occurs to me that the decision to buy these vehicles in the first place can also be modeled using many, many iterations of the Prisoner's Dilemma played against every other driver. Here's how such a model might be constructed. The options are :

  • Buy an SUV (defect)
  • Buy a compact car (cooperate)

In a single round of Prisoner's Dilemma, it is usually reasoned that the only rational choice is to defect. However, when two individuals play many iterations against one another, more interesting strategies can succeed. The strategy that seems to do the best in most situations is some variant of generous, randomly forgiving tit-for-tat. To apply the Prisoner's Dilemma to the automobile market, you must view the game as continuously ongoing because a player can trade in their car for a different model at any time, and the game is played against every other driver on the road. Each iteration makes a marginal contribution to the total outcome for the player. For example, the actual risk of death is the sum over the marginal risk of death arising from the outcome of each game.

The outcomes are :

Player's Choice
defect cooperate
Stranger's
Choice
defect Punishment for Mutual Defection

Both players buy an SUV, negating the advantages of owning a larger vehicle. Both players are penalized with substantial marginal increases in traffic congestion, gas prices, risk of death, risk of injury, and rate of damage to shared environmental resources.

Sucker's Payoff

Player suffers moderate marginal increase of gas prices, traffic congestion, and rate of destruction of shared environmental resources than the Punishment for Mutual Defection. However, the player suffers a worse view of the road and substantially increased marginal risk of death and injury.

cooperate Temptation

Player suffers a moderate marginal increase of gas prices, traffic congestion, and rate of destruction of shared environmental resources than the Punishment for Mutual Defection. They also enjoy better view of the road and a substantially reduced marginal risk of death or injury.

Reward for Mutual Cooperation

Both the Player and the Stranger enjoy a better view of the road and substantial marginal reductions in gas prices, traffic congestion, rate of destruction of shared environmental resources, and risk of death and injury.

In computer models of the iterated Prisoner's Dilemma, and in real-world situations are well represented by the model, strategies that are "nice," "generous" and "forgiving" tend to thrive. These terms have a technical meaning here. "Nice" simply describes a strategy that will not defect first, "generous" describes strategies that will not retaliate against other players when they defect under some circumstances, and "forgiving" describes strategies that will "forget" about past defections of other players. Richard Dawkins describes this in some detail in The Selfish Gene (see Chapter 12: Nice Guys Finish First), basing much of his argument on the research of Robert Axelrod.

If the automobile market really can be modeled using the iterated Prisoners Dilemma, then we would expect to see the most successful strategies in Axelrod's tournaments, which are mostly "nice," become the dominant strategy for car-buying. That is to say, we should see mostly compact cars. So, why do people keep buying SUVs? They are playing Defect against the rest of us, hoping to receive the Temptation outcome from most of the iterations of the game.

This is especially curious because because both the Punishment for Mutual Defection and the Sucker's Payoff are very severe. It doesn't take very many people playing Defect to block the view on the road, to drive up gas prices, to dramatically increase the risk of death an injury for all drivers, and to accelerate the rate of destruction of our shared environment. The Reward for Mutual Cooperation should be a very strong attractor in the problem space.

It's very tempting to think of SUV buyers as stupid, or as assholes, or as sociopaths. However, it is more useful to model the decision as a purely rational decision based on what they think will be the best strategy. For most people, it probably isn't a rational choice, but that doesn't actually matter. In the model, we pretend that the players are playing as if they are making rational choices. This is how computers play Prisoner's Dilemma, even though they aren't capable of rational choices.

Game theory offers a fairly convincing (and rather grim) explanation for the phenomenon of SUVs. It makes less sense to play Cooperate if you don't think the game will go on for much longer. On the last round of the game, it becomes the classic, non-iterated Prisoner's Dilemma for which the only rational choice is Defect. Everyone knows that we're running out of oil. Consciously or unconsciously, people are behaving in a way that suggests that the shadow of the future is shortening.

Tiptoeing around perjury

Posted by Russell on September 11, 2007 at 2:29 p.m.
While I listened to Petraeus and Crocker tiptoe clumsily around perjury, I couldn't help but wonder how many people will take them at their word that the level of violence is declining. I find it difficult to understand how the level of violence is decreasing when the rate of killing has been increasing. I guess it must depend on how you count the bodies. Evidently, ordinary muggers shoot people in the face, and death squads shoot people in the back of the head. Accepting, for a moment, this ridiculous criterion for distinguishing muggings from sectarian killings as reasonable, it seems very weird that we don't count muggings as violence.

Ambassador Crocker, for his part, repeated the assertion that Iran is supplying the insurgency with sophisticated weapons, particularly explosively formed penetrators. If you will direct your attention to the photograph below, from Wikipedia :

This is a sophisticated weapon that exploits some very tricky hydrodynamics. It is also improvised from an ordinary copper pipe. The penetrator (the bowl shaped part) looks like it was turned out on a lathe, and that the machinist was either not very skillful or not very concerned with quality. Note the disk-shaped depression in the center where the lathe spindle was attached. The penetrator appears to be soldered to the pipe with plumbing solder.

I don't think the insurgency needs anyone's help to build these. The hardest part would be obtaining the explosive material. Who is supplying the insurgency with explosives? The simplest explanation is that they helped themselves to the weapons caches we left unguarded at the beginning of the war. How many improvised explosively formed penetrators could you make with 377 tons of high explosives?

Maybe Iran isn't being very helpful when it comes to American interests in Iraq. After all, why should they? I have no doubt that Iran's leadership would be delighted to see things go as badly for America as possible in Iraq and elsewhere. However, it's not as if Iran actually has to do anything to make Iraq a disaster for America. The fact that they don't like us is not in itself a very good reason for them to arm the insurgents. Practically any government in Iraq is likely to be friendly with Iran. Iran actually has a lot of good reasons to want the insurgency to stop.

If I were Mr. Ahmadinejad, I would just sit on my hands. At most, I would give some political support to Iraqis who might be friendly to Iran should they gain or keep power. But weapons? Why bother when the insurgents have already looted all the weapons they could ever want? It would be redundant and unnecessary.

Like most Americans, Mr. Crocker knows that we've either lost or that we're loosing. What sets him apart from the rest of us is that Americans are grown up enough to accept responsibility for the bad outcome of this conflict, and Mr. Crocker would rather blame it on someone else.

The Surge Isn't Working

Posted by Russell on September 05, 2007 at 9:24 p.m.
Charles Boustany turned up on CNN to peddle the administration's latest outrage -- that the surge has reduced violence in Iraq substantially. So, Wolf Blitzer asks a hard question :
BOUSTANY: We’re clearly seeing some major improvements. Clearly in the Anbar Province, we’ve seen significant improvement. We were able to walk the streets of Fallujah. Sectarian deaths are down.

[...]

BLITZER: And Congressman Boustany, you say that the number of casualties is going down. But we took a closer look — and The Los Angeles Times did as well — citing Iraqi Health Ministry numbers. In June, it was 1,227 civilian deaths in Iraq. In July, it went up to 1,753 civilian deaths in Iraq. And in August, the month that just ended, 1,773 civilian deaths in Iraq. Those numbers are going in the wrong direction.

Ah, the numbers. It is rather alarming how often important news comes without any specific discussion of the numbers upon which it hinges. Someone needs to send Mr. Blitzer a pundit-snack. Good pundit.

But reading a triad of four digit numbers from a teleprompter (or maybe even from memory) is not the best way to communicate about numbers. That might be appropriate for MegaMillions, but we owe these particular numbers more careful examination. We are, after all, talking about the deaths of human beings as a direct result of our collective decisions at the ballot box.

So, I looked up the data on conformed killings of Iraqi civilians. Against the background of men and women and children turning up as abandoned corpses on the street, there are a lot of mass-casualty events. There are also a few rare days when there are no confirmed killings. It's somewhat difficult to see the trend in the raw data. So, I borrowed an analytical tool from the financial world -- the moving average.

That looks like a slight upward trend to me. The GAO agrees. Their data measures the number of attacks, rather than the number of dead, but one would expect attacks and deaths to correlate.

General Patreous is going to make his presentation in a few days, which everyone assumes is going to say that the surge is working. If it doesn't explain these numbers, then the report should be ignored.

GPL vs. BSD : Huullauauahgha!

Posted by Russell on September 02, 2007 at 4:26 a.m.
Evidently, when a chunk of software is simultaneously licensed under the BSD license and the GPL, it becomes unusable to projects that use the BSD license. No, wait. GPLed projects can borrow BSD licensed code, but not visa versa. No wait. When a chunk of code is under a dual BSD/GPL license, you get to pick which one to follow, which means you can ignore one of them.

Fuck. I hate this shit.

How about this :

The No-Lawyers License

Permission is hereby granted for the use of this file and all of its contents and any representation, derivative, or portion thereof for any purpose whatsoever, unless :
  • You are a lawyer
  • You are an employee of a law firm
  • You are a contractor of a law firm
If the conditions above are violated, you are prohibited from examining, discussing, writing about, quoting, referencing, citing, or interpreting this file or any of its representations, derivatives or portions for any purpose whatsoever.
I just want to write code and let other people use it. If people make improvements, I'd be happier if they gave their improvements back to me. Why is this so goddamn difficult?

Garage Sale

Posted by Russell on September 01, 2007 at 10:48 p.m.
I've got too much crap. I want to sell some of it. If you see anything you like, email me!

I have posted a Flickr gallery of all the stuff I'm selling.

Vintage WiFi Station -- $15

This is a commercial-grade Nokia 802.11 access point. Yes, 802.11, not that fancy Johnny-come-Lately 802.11b or that bling-bling 802.11g. The original.

It runs at a stately 2 MB/s, with none of this rushing around at manic 11 MB/s speeds or barbaric 54 MB/s speeds. It has a removable Bay Networks BayStack 660 PCMCIA card, which I presume can be replaced with something more modern if you want to spoil the experience. And it is an experience, let me tell you. I've done no fewer than six Debian installations over this wonderful example of Scandinavian craftsmanship.

Lest you think this device is obsolete, I should point out that it works just fine with newer WiFi cards. Also, ask youself this: How fast is your internet connection, really? Is it faster than 2 MB/s? Probably not. Probably, you pay for 768 KB/s downlink, and you actually get 480 KB/s. You aren't fooling anyone with that fancy 54 MB/s 802.11g access point (that only actually runs that fast when you put your laptop directly on top of it, anyway). Your bits aren't moving any faster that your ISP says they will.

It's WiFi from a more civilized age.

Laser Level -- $25

Bulldog laser level, complete with tripod, carrying case, and eye-protection. Yours for $25.

Intel Centrino mini-PCI WiFi card -- $30

This was the original card that came with my IBM ThinkPad X40. I wanted an Atheros-based card, so I bought one and replaced the Centrino card. It's been sitting in its little anti-static bag since ever since.

See no evil, hear no evil...

Posted by Russell on September 01, 2007 at 9:59 p.m.
For various reasons, a lot of people remain very skeptical about global warming. The most often cited (sane) reason for maintaining this skepticism is that the data has been patched together from many different sources, and that no single source of evidence conclusively demonstrates that global warming is occurring. With such a complicated argument, perhaps there are alternative explanations, one might wonder.

The important thing about global warming is that it is a theory, and thus it is falsifiable. If there are doubts about the validity of this theory, we can design an experiment that would reliably falsify the theory if it were, in fact, wrong. NASA has designed and built such an experiment, called Deep Space Climate Observatory (DSCOVR). It would sit at the L1 Lagrange point between the Earth and the Sun, where it can continuously observe the Earth's daylight side. From this vantage, it would calculate an accurate, up-to-the-minute energy budget for the whole planet. It would also collect detailed measurements of the atmospheric and surface composition of our planet.

If anthropic global warming is a bad theory, then DSCOVR would shoot it down in a hurry. On the other hand, if the theory is correct, as most climate scientists have concluded already, DSCOVR would provide us with simple, conclusive evidence gathered with uniform methodology.

But the global warming skeptics, or at least the ones in Congress, have never been interested in actually falsifying the theory. They were much happier wallowing in ignorance.

Republicans didn't buy it. In 1999, GOP Congressmen put the project on ice, calling it the "Goresat," a "multimillion-dollar screen saver." Dick Armey, then House Majority Leader, quipped, "This idea supposedly came from a dream. Well, I once dreamed I caught a 10-foot bass. But I didn't call up the Fish and Wildlife service and ask them to spend $30 million to make sure it happened."

Lost in the grandstanding was the critically important science behind DSCOVR. In January 2006, NASA quietly canceled DSCOVR altogether, citing "competing priorities." Many in the scientific community are incredulous that such an important mission might be lost to rank partisanship. "Gore favored it," says Dr. Park. "This administration is determined that a Gore experiment is not going to happen. It's inconceivable to me." Climate analyst Trenbeth said, "It makes no sense to me at all either from an economic or a scientific viewpoint. That leaves politics."

Science ran a letter from Francisco P. J. Valero titled Keeping the DSCOVR Mission Alive. I will quote the relevant part since most people don't have access to articles in Science :
Our proposal was selected by NASA after rigorous scientific and technical reviews. Solar activity observations were added at NASA's request to satisfy scientific needs and NOAA's operational requirements for space weather monitoring. DSCOVR is firmly based on the ideas developed by the science team. The transmission of live images of Earth added to the educational outreach component of the mission but was by no means the primary objective.

Many scientists, both in the United States and abroad, view DSCOVR as one of NASA's most important and innovative Earth science missions. The satellite has been built and could still be launched in time to provide synergistic data coincident with current and future orbiting systems. It offers great potential both as a source of fundamental scientific observations and as a pioneering Earth sciences mission from deep space.

France and the Ukraine have offered to launch it for us, but NASA has rebuffed their offers.

Next time you find yourself arguing with someone about global warming, tell them that the experiment to prove or disprove it, once and for all, was canned by Congress when the Republicans were running it. By their own admission, they canned it because they wanted to humiliate Al Gore. All we have to do is launch the damn thing, instead of letting it sit in a box at Goddard Space Flight Center at the cost of a million dollars a year.

At last, some clarity

Posted by Russell on August 26, 2007 at 5:24 a.m.
From the moment it became clear that the stated reasons were both manifestly ridiculous and demonstrably false, petabytes have been devoted to speculation about the "real" reason why the United States invaded Iraq. They range from "'everyone' believed that there were WMDs..." to simply "the oil." Thus far, I have found no explanation that is particularly compelling, so I've left the question unanswered in my mind.

That is, until The Editors provided one that can turn aside old Occam's Razor. Of course it's speculation. However, since even the best friends of the White House can only speculate on what goes on in there, speculate is all we can do. This administration is a black box. Well, a black box from which leaks a steady drip of incompetence and malfeasance, but a black box nonetheless. I suspect that even with the benefit of historical perspective, the academic study of early 21st Century American History will do no better on this topic than speculating on the circumstantial evidence.

The Editors offer what I consider the first successful sally in this endeavor. If it's anywhere close to true, then I think its profanity is completely justified.

Science and Islam

Posted by Russell on August 24, 2007 at 4:58 p.m.
This month's Physics Today has a fascinating article by Pervez Amirali Hoodbhoy about the fate of science in Islam. Dr. Hoodbhoy is a professor of nuclear physics at Quaid-i-Azam University in Islamabad. He covers a lot of ground, from the golden age of science in the Muslim world (the 9th-13th centuries), it's collapse with the rise of Asharite fundamentalism, to science in modern Muslim states.

Americans should look carefully at what happened in Baghdad in the 13th century. The Muslim world was resplendent civilization of intellectual tolerance, cultural pluralism, and political liberalism. This period came to an abrupt and bloody end with the overthrow of Mu'tazilah thinkers and leaders and their replacement with the stricter, inflexible, literalist Asharite thinkers. The bloody death of rationalist religious inquiry splashed across every aspect of civilization, dooming science, politics and culture to a prolonged dark age.

Americans would be well served by the study of this sad patch of history. It has many important parallels with our own inflexible, literalist religious doctrines.

Science finds every soil barren in which miracles are taken literally and seriously and revelation is considered to provide authentic knowledge of the physical world. If the scientific method is trashed, no amount of resources or loud declarations of intent to develop science can compensate. In those circumstances, scientific research becomes, at best, a kind of cataloging or "butterfly-collecting" activity. It cannot be a creative process of genuine inquiry in which bold hypotheses are made and checked.
Hoodbhoy's argument here is broadly applicable. It is just as true for Islam as for Christianity, or Judaism, or any other religion. It is even true for non-religious doctrines. The study of physics was able to flourish under Stalin, but evolutionary biology and genetics, which tended generate ideas embarrassing to the cause of Communism, were repressed and grossly distorted.

Could this happen in 21st century America? You bet.

Boiling Nukes

Posted by Russell on August 17, 2007 at 8:35 p.m.
Like coal and gas power stations, nuclear power plants are heat engines. They produce power by exploiting the difference in temperature between two heat reservoirs. When most people think of a nuclear power plant (or any heat engine, really) the component that naturally dominates one's attention is the hot reservoir -- the reactor. The reactor contains most of the clever science and engineering, so it commands attention. But it takes two reservoirs of comparable heat capacity to make a heat engine.

Surprisingly, though, the electricity production of a given power plant is usually not limited by the reactor. We know how to build staggeringly enormous reactors, and even small reactors can be designed to run extremely hot. Rather, the generating capacity is limited by the heat capacity of the cold reservoir, which is a function of the natural environment in which the power station is situated. Nuclear reactors are cooled by water, so the generating capacity of a nuclear power plant is directly proportional to the quantity and temperature of water available from the environment.

So, what happens when there is a drought? Or a heat wave? Or both? The heat capacity of the cold reservoir shrinks, and the generating capacity of the power plant shrinks with it. It doesn't matter how big and fancy the reactor is if there isn't enough cooling water.

The water in the Tennessee River has gotten so hot this summer -- more than 90 degrees Fahrenheit averaged over a day -- that the TVA was forced to shut down one of the reactors at Browns Ferry. The heat capacity of their cold reservoir has shrunk so much that they can only operate two of their three reactors. The TVA is already suffering from reduced production at their hydroelectric stations due to drought conditions.

The lesson here is that nuclear power isn't simply a solution to global warming. It a technology that is threatened by global warming.

Turnabout

Posted by Russell on August 15, 2007 at 9:24 p.m.
Evidently, no one noticed that in passing the reauthorization of the Patriot Act, Gonzalez will get yet another nifty new power. Now, he can fast-track the process of killing prisoners. Hurray!

I wonder if it has ever occurred to the friends of the administration to wonder how these various expanded powers might be exploited by a hypothetical power-hungry, incompetent and ruthless ultra left-wing Democrat. It wasn't that long ago that people were actually somewhat concerned that a seemingly moderate Democrat might turn out to be a card-carrying Communist taking his instructions (or his ideas) straight from the Politburo. On the basis of such a possibility, wouldn't one want to blunt the power of such a disastrous individual by insisting on a limited executive?

I think we can take Republican party's embrace of expanded executive power as sufficient proof that they understand that the radical left is dead. They know that the most sinister thing the Democratic party has to offer is a few small-time crooks and the occasional philanderer. We can take the very fact that supposedly serious people are willing to promulgate the idea of a "unitary executive" as evidence that the advocates of the theory do not expect their political opponents to exploit such powers.

They are probably correct. If one may indulge in some speculation, what would Al Gore, had he been elected and had turned out to be a foaming-at-the-mouth enviro-communist, have done with the power to indefinitely detain people as "enemy combatants?" Whose phones would evil-universe Al Gore illegally wiretap? I can't imagine any answer to these questions that isn't just plain silly.

Barring some exceedingly bizarre event (e.g., the conquest of the United States by space aliens), I will probably vote for one of the Democratic presidential candidates next November. For the first time in living memory, we face the refreshing dilemma of choosing among genuinely good candidates, rather than the drudgery of selecting the least odious. I have to admit that even my least favorite Democratic candidate would probably make a pretty good president. But I wouldn't trust any of them with the wiretapping powers Congress granted to this president by passing the legislative turd that I shall dub the Illegal Wiretapping Reauthorization Act of 2007.

So there you have it, folks. The Republican leadership trusts any Democrat to exercise executive power responsibly and effectively. If they didn't, then they would be less enthusiastic about the expansion of executive power. Clearly, they trust the field of Democratic candidates more than I do.

If I were on The Simpsons

Posted by Russell on August 14, 2007 at 4:47 p.m.
The Simpsons and Burger King have a cute little Flash application that lets you turn yourself into a character on the show. Here is what I would look like, I suppose, if I appeared on The Simpsons :

I'm curious how much it actually does with the photo you upload. I wish they had one for Futurama. I think it would be even cooler to be a head in a jar.

The Metro

Posted by Russell on August 11, 2007 at 11:09 p.m.
While I was on jury duty last week, I rode the train from Pasadena to the courthouse in Downtown LA every morning. One of the best things about jury duty, I think, was riding the train. I took the Gold Line from the Lake Street station in Pasadena, switched to Red Line at Union Station, and then switched to the Blue Line at 7th Street, and hopped off at Grand, less than a block from the courthouse. The whole trip took took about 40 minutes when I caught a local train at Lake Street, or about 28 minutes if I was lucky enough to catch the Express. Driving from Pasadena during rush hour would have been... excruciating. At least an hour and twenty minutes.

I miss the train. It was quiet (except, inexplicably, for the tunnel leaving 7th Street), fast, and comfortable. I was always able to find a seat, even during peak hours. The stations are nice. I got a lot of reading done, and the scenery is interesting. If anything, my opinion of Angelenos has improved considerably from the random sample I encountered.

Now that I've been released from the jury, my trips to UCLA in West Los Angeles are by car. The train doesn't go here, and the buses from Downtown are slow, infrequent and astonishingly crowded. My most recent ride on the 720 bus featured a fifteen minute interval smashed face-to-face into the enormous pot belly of a 400-pound black man, who didn't seem to enjoy the experience any more than I did. No amount of shuffling and begging ones pardon were sufficient to disengage skin contact. The only solution was to stare out of opposite windows and wait for the rumbling glacier of sweat, flesh and steel to reach its destination. Riding the bus sucks.

West LA needs to get with the program, or it's going to become a slum. All the interesting new development in Los Angeles is happening Downtown, and the new zoning changes are only going to accelerate that. Running the Red Line down the Wilshire corridor to Ocean Boulevard is only a start. The proposal to turn Pico and Olympic into paired one-way streets is utterly idiotic, but understandable given that people in West LA would probably chew off their leg before allowing a even a single precious lane to be sacrificed for a light rail project.

Are we worried yet?

Posted by Russell on August 09, 2007 at 1:56 a.m.
I know that individual events, however strange, can't necessarily be attributed to global warming. But... A tornado in Brooklyn?

Jury Duty

Posted by Russell on August 06, 2007 at 9:39 p.m.
Finally, the judge released from jury duty, so I can talk about what I've been doing for the last week-and-change.

The case was pretty simple, but wasn't completely cut-and-dry. Here is the basic sequence of events :

  1. There was a birthday party with about 12 people. The defendant was one of the guests.
  2. The party ended, and the guests went to the sidewalk to get their cars.
  3. The valet brought her 2007 Mercedes S-class to the curb, but did a crappy job of parking it.
  4. Another car (an brand new Austin Martin) stopped to wait for the defendant's car to pull out.
  5. Traffic backed up for about a block (a long block).
  6. Two motorcycle officers saw the traffic, and noticed that the blockage started at the valet area. This had happened before. They made a U-turn to see if they could get things moving again.
  7. ???
  8. The defendant, now in her car, pulled away from the curb. The Austin Martin took its spot, and traffic started moving again. The officers decide that nothing more needed to be done.
  9. The defendant's car stopped after traveling about the length of two parked cars. The defendant later explained that this was to put on her seatbelt.
  10. Seeing that traffic was once again blocked, the officer activated his lights and his squawker.
  11. The defendant moved her car up the street about the length of three parked cars, and turned onto Hollywood Blvd, where she yielded to the curb.
  12. The officer had only intended to prod her into moving along, but since she had pulled over, he figured he should investigate a little more.
  13. The officer smelled alcohol as soon as the window was rolled down.
  14. The officer ordered her out of the car and performed a field sobriety test, on which the defendant performed poorly (but not the worst he'd ever seen). The officer then offered her a voluntary breathalyser test, which measured her at more than twice the legal limit. She was arrested, booked, and tested again at the police station with a more sophisticated machine, where she once again came in at more than twice the legal limit.
She was charged with driving under the influence and with driving with a 0.08 BAC or above.

The sticky part was what happened at between items 6 and 8. The arresting officer testified that the defendant was in the car the whole time. Basically, that nothing happened between item 6 and 8. The defense alleged that the defendant was waiting for her designated driver, and that the officer ordered her into the car, and ordered her to move it. Unfortunately, the evidence that might have supported this allegation (witness testimony) was apparently deemed inadmissible.

I suppose that the judge decided that whether or not she was ordered to drive was irrelevant, on the grounds that she could have refused the order. However, one of the key elements needed to sustain this kind of charge is that the act needs to be voluntary and deliberate (although one need not necessarily intend to break the law). If the officer's order somehow stripped her of her volition, that may undermine the charge.

However, we were never permitted to hear evidence to support the allegation that she was ordered into the car. Evidently, the judge didn't buy the argument that such an order might have stripped the defendant of her volition. So, based on the evidence we had on hand, we were forced to hand down a verdict of guilty on both charges.

Personally, I would have preferred to hear the argument and evidence pertaining to her volition. I probably would have urged a guilty verdict anyway, but I think it might have been relevant. After all, if a police officer orders you to do something, most people feel an extraordinary pressure to comply. If, in this case, the officer orders you to do something that happens to be illegal, I suppose it must be ones own responsibility to refuse. If that is what happened, the argument should have been vetted before the jury. It might not have helped the defendant, but if that is why she did what she did, she should have been permitted to explain herself.

Anyway, I'm very curious to find out what arguments were made during the sidebar discussions. Maybe I'll feel better about the verdict when I find out what was kept secret from us.

Otherwise, the experience was very interesting. We had a very entertaining bailiff. If you ever get pulled over by a Los Angeles County Sheriff named Rodriguez, and who has big tattoos on her biceps and talks very fast, she's only acting like a jerk. She's actually a very nice person. The jury had a lot of interesting people.

Oh, and George Takei was in my jury pool. He was dismissed, but I got a chance grumble a little about transportation to the courthouse with him and to say hello as he was leaving the next day. I wasn't quite sure if it was him, but his voice is absolutely unmistakable. He's also a really nice guy in person, though I don't think that's really news to anyone -- except maybe Tim Hardaway.

Smog in your heart

Posted by Russell on July 26, 2007 at 3:09 p.m.
Just in case you didn't have enough reasons to hate smog, researchers at UCLA's David Geffen School of Medicine have announced the results of a study concluding that exposure to diesel and coal exhaust causes heart disease. Many people live for years with elevated cholesterol without developing heart disease, and many people live with smog without developing heart disease. However, it appears that the combination of elevated cholesterol and exposure to fine particles from hydrocarbon combustion activate the genes that lead to the hardening of arteries.

So, if you live in the city, then you really need to listen to your doctor if she tells you to lower your LDL/HDL levels.

Anyway, I suppose PG&E is moving in the right direction by building the world's largest solar plant in Southern California -- a 6000 acre, half-gigawatt solar thermal plant in the Mojave desert. PG&E has contracted Solel, and Israeli company specializing in solar energy, to build the plant. There are already nine solar thermal plants operating in the Mojave desert, totaling 354 megawatts in capacity. When the new plant comes online, Mojave will have nearly a gigawatt of solar thermal generating capacity.

According to LADWP, the city's peak demand is 5.7 gigawatts, and a little more than half of that demand, or about 2.97 gigawatts, is met by burning coal. Assuming LADWP substitutes the new solar thermal capacity for coal capacity, LADWP could reduce its utilization of coal generating capacity, and thus emissions from coal, by about 18%. That's a significant chunk, but not nearly good enough.

IKEA: Instructions lost and found

Posted by Russell on July 20, 2007 at 7:18 p.m.
Figuring out how to reassemble IKEA products is probably a common problem for people when moving. Fortunately, if you threw away the instructions, you can always download them again from the IKEA website.

Now, the only problem remaining is to remember the unpronounceable Swedish product name.

Watch them go

Posted by Russell on July 18, 2007 at 3:15 a.m.
The Republicans are filibustering the amendment to Defense Authorization bill, and Mr. Reid is forcing them to actually stand up and do it. It's been quite fun watching them sleepily fumble through their speeches. The opponents of the filibuster look and sound like they planned well. They've had their naps and their coffee, and have been turning up for their 3 AM speeches ready for a fight.

A lot of people have been calling this political theater, and that real debate doesn't happen during these marathon sessions. The speeches so far, though, have been pretty serious.

Mr. Reid has threatened to instruct the sergeant at arms to round up enough senators to keep the quorum. I'd love to see some senators -- of either party -- dragged half-asleep onto the Senate floor in their pajamas.

The Common Thread of Failure

Posted by Russell on July 12, 2007 at 3:03 a.m.
A few days ago, a skunk died behind my house. Even a tiny whiff of the sent carries the unmistakable note of death. The smell is caused by two compounds, cadaverine and putricine, which form as a result of protein hydrolysis during putrefaction of animal tissue.

The testimony of Richard H. Carmona before Congress about his term as Surgeon General is tainted with an all-too-familiar stink. It's like catching the cadaverine-putricine whiff of decaying flesh while walking in the garden. There can be no mistake about what it signifies.

There is a common thread that runs among this sad episode and the US attorney purge, the Katrina disaster, the Libby/Wilson/Plame/Armitage clusterfuck, the missing WMDs, Abu Garib and the generally brain-dead strategy of the Iraq war.

This administration doesn't know what a civil servant is.

As we are reminded ad nausium, US attorneys, the surgeon general, the secretary of defense, and everyone else in the executive branch serves "at the pleasure of the president." This is true, in a general sense. What the administration doesn't understand is that this does not mean that these people serve to please the president.

It is the job of the president to choose the best technocrats he or she can find. Once installed, it is the job of the president to insure that these people can practice their trade. But this administration believes it knows the law better than the US attorneys it hires, military planning better than the War College, foreign intelligence better than its own intelligence analysts, disaster planning and emergency response better than FEMA, operational security better than the CIA, interrogation and detention practices better than the military police, and medicine better than its own surgeon general.

But they don't. No politician could. That's why we have experts.

Moved!

Posted by Russell on July 07, 2007 at 11:41 p.m.
I guess it's more or less official now, so in the grand tradition of the inter-tubes, it requires a blog announcement. I've moved out of my apartment near UCLA, so I'm not essentially homeless. I'll be shuttling around between Pasadena, UCLA and Cypress for the foreseeable future.

I suppose that means I'll be inhabiting the guest house behind my mom's house, but right now the situation has more to do with storage than inhabitation.

Now I get to find out how much of my security deposit my landlord will return.

Happy Birthday, USA

Posted by Russell on July 04, 2007 at 5:42 p.m.
Only one week ago, the Bald Eagle was officially taken off the List of Endangered and Threatened Wildlife. This is the first Independence Day since 1918 that the Bald Eagle, the symbol of our nation, has been considered safe from extinction. In celebration of this achievement, I would like to offer my thanks to the man who did the most to make this possible: Richard Nixon.

While its image fluttered over the California statehouse in Sacramento, the California Brown Bear was driven to extinction. The last one was shot in 1922. The UCLA Bruins are named for an extinct species. With the extinction of Ursus californicus, the flag of California has become a pathetic commentary on the mismanagement of our natural resources. With the Bald Eagle's removal from the list, America has dodged that particular humiliation.

Most people agree that Richard Nixon was, by nearly every measure, a terrible leader. In his domestic and foreign endeavors, he left a legacy of terrible failures. In foreign policy, Nixon's failures were numerous and severe :

  • He escalated the war in Vietnam by secretly (and illegally) bombing Laos and Cambodia.
  • He encouraged and aided the overthrow of Chile's government by Augusto Pinochet.
  • He gave material support to Yahya Khan, the dictator of Pakistan, during Bangladesh's war of independence, putting America in a position of complicity in genocide.
The bright spot in this record of failure was that he was able to drive a wedge between China and the Soviet Union. This was an important strategic achievement, but it came at the expense of betraying an ally, Taiwan. This did little to help the of reputation of American friendship. The Nixon Doctrine of replacing American troops in Vietnam with South Vietnamese soldiers was a military failure, but succeeded as a politically feasible way of getting out of the war.

But it isn't fair to remember Nixon simply for his failures and Pyrrhic victories. So, for today, let's remember Richard Nixon for his achievements on his watch. Among them, Nixon...

  • indexed Social Security to inflation
  • created the EPA
  • proposed, signed and enforced the Endangered Species Act
  • created the Supplemental Security Income
  • created Occupational Safety and Health Administration
  • helped create hundreds of state parks
  • raised wages for federal employees
  • implemented the first affirmative action program
But the most important thing Nixon did, ultimately, was resign. He recognized that the nation was more important than his own hopes and goals for his tenure in office. He had the courage to admit that his failures had grown too numerous and too serious, and he decided that the best way to serve the nation was to offer his resignation.

For all his faults, Nixon's final act as president was to place his country before himself. He was in many respects a very poor president, but he still managed to leave behind a legacy important achievements. Every time you see a seal depicting the Bald Eagle, remember that it Richard Nixon helped save it. So, on this Forth of July, I'd like to salute Nixon's tarnished patriotism. Let his epitaph be, "In the end, he was a patriot."

...and they did.

Posted by Russell on July 03, 2007 at 4:18 a.m.
Four years ago today, George Bush said this :
"There are some who feel like, that conditions are such that they can attack us there. My answer is: Bring them on. We got the force necessary to deal with the situation."
-- George W. Bush on Iraq, 2 July 2003
Nowadays, "they," being the insurgency, attacks us "there," being nearly every corner of Iraq, on a daily basis. Nearly every day, in ones and twos and sometimes more, our guys are getting picked off.

The deaths happen with such regularity that the news has ceased to say very much about these singular, individual and profound losses, but write instead to the general condition of having our soldiers die in Iraq. The news from Iraq is reported in the much the same manner as the general condition of the weather. The reporting on casualties has the same tone you might expect to hear, "It has been hot this Summer."

Today, George Bush celebrated the anniversary of "Bring them on" by commuting Scooter Libby's prison prison sentence. Scooter Libby, who perjured himself before a federal grand jury in an effort to cover up the deliberate and criminal disclosure of the covert status of a an operating CIA officer causing the endangerment and/or loss of valuable intelligence assets, was effectively pardoned today.

George Bush must be aiming for an approval rating in the 15% range.

Ubuntu on Dell: Good and Evil

Posted by Russell on June 20, 2007 at 4:39 p.m.
For Father's day, I've been helping my dad get Ubuntu working on his new laptop (a Dell Latitude D420). Getting Ubuntu configured has turned out to be surprisingly painless, especially compared to Windows XP.

My dad had originally hoped to buy a machine with Ubuntu pre-installed. Unfortunately, getting Dell to actually sell you a computer with Ubuntu is more or less impossible. My dad isn't the only one to come to this conclusion. HP and IBM have a similar approach; they make a big deal of offering Linux pre-installed on their hardware, but it's only offered on a tiny and undesirable subset of their products, and the sales department will do everything possible short of hanging up on you to prevent you from buying one. So, he gave up and bought the machine he wanted, figuring he'd postpone his switch to Ubuntu.

After a failed attempt to restore his Windows XP installation from backups on is old computer, reinstalling XP from the provided CD turned out to be a neigh impossible task. With no drivers for any of the hardware (even the USB bus), once the OS was loaded, we couldn't think of a way of getting the drivers onto the disk so they might be installed. The machine uses a USB CD drive, so without the USB bus drivers, you can't even burn a CD with the drivers. The needed drivers are probably somewhere on the XP install CD, but there's no way of getting them.

So, we figured we'd give Ubuntu a shot after all. The process could hardly have been more painless. The only shortcomings of the Ubuntu install process are legally imposed and have easy workarounds -- fetching the Broadcom firmware for the wireless card, for example. After completing those chores, the machine Just Works.

My dad is a smart guy, so I wasn't worried about the "normal" sorts of troubles in switching to Linux. When you switch to a new OS, there is a reasonable expectation of effort required to learn the new environment. He'll figure out how to use the the software and OS features on his own. I was worried about poor hardware support. My dad can figure out how to install software and use it without my help, but it'll be a while (if ever) before he would consider compiling his own kernel to fix a hardware issue. It's not reasonable to expect someone who is switching to a new OS to repair it and learn it simultaneously.

Fortunately, all of the headaches I was fearing seem to have been addressed. It suspends and resumes without complaint, you can join wireless networks (including encrypted ones) from a nice little drop down menu. The network menu lets you switch between an ethernet connection and a WiFi connection if both are available. The Add/Remove Software application is intuitive and easy to use. No indoctrination into kernel compilation and command line tools is immediately necessary.

So, our assessment is that Ubuntu is, so far, much more user friendly than Windows. An inexperienced computer user would have a better chance of getting Ubuntu installed correctly than Windows. On this hardware, it wouldn't be all smooth sailing, but it's pretty close. If you're experienced enough to know the definition of words like "partition" and "firmware," then it's a piece of cake.

It's a shame, really, that Dell won't sell Ubuntu on this machine. Ubuntu is slick, snappy, easy to use, and it makes their hardware look good.

My dad's only complaint so far has been, "Yuck. This brown color is ugly. How do I change the color scheme?"

Non-Odious DSL

Posted by Russell on June 13, 2007 at 5:50 p.m.
Well, now that Speakeasy has been acquired by Best Buy, I'm going to give up on it. I had such high hopes, but now I feel like an asshole for ever recommending them. The customer service has been rude and unhelpful (to my mother, no less!), the installation was painful, it's overpriced, and the actual service is miserably slow. And by slow, I mean like dial-up slow.

One thing I liked about dial-up service was the profusion of choices. There were dozens, and in some places, hundreds of ISPs. The ISPs offered lots of features and competitive prices. Now, the "choice" usually boils down to :

  • Your friendly local cable monopoly, or
  • Your friendly local telephone monopoly
Not unexpectedly, we pay high prices for crappy service. The monopolist providers cheerfully spy on us on behalf of quasi-legitimate entertainment cartels and clearly illegal government programs.

I want my choices back. There are a lot of smallish local DSL providers in LA, like Pacific Online and LA Bridge. Has anyone out there had any experiences (good or bad) with smaller DSL providers?

GPS!

Posted by Russell on June 07, 2007 at 11:41 a.m.
My dad bought me a GPS unit for my birthday! I suppose my chronically poor sense of direction is becoming legendary, and upon hearing that I plan on visiting Mimi while she's studying in Beijing, he decided that I would probably need some help getting around.

In truth, I actually don't have a bad sense of direction. I have a bad sense of timing. I usually know exactly where I am going and how to get there, but I often don't realize where I am in time to make the right turns.

Fortunately, one thing I am not going to do in Beijing is drive. I'm not particularly worried about the drivers in Beijing, though. I spent many years driving in Boston on a daily basis, so the belligerence, recklessness, carelessness and stupidity of other drivers is something I've grown expect. Rather, I refuse to drive in Beijing because cars are rolling legal time-bombs. Almost every aspect of a normal automotive experience is intimately tangled with litigation, prosecution and/or the potentiality of litigation and prosecution. Automobiles are pretty much the only means by which a normal person can accidentally break the law. It's practically inevitable, in fact.

So, I'm sure as hell not going to risk driving a car in a country that doesn't have an independent judiciary. I don't care how careful or how reckless the drivers are. It's much more likely that you will make a mistake leading to an accident than for someone else to randomly hit you, especially over a short period of time. So, if I wind up in court, I'd prefer it weren't a kangaroo court.

Anyway, the GPS unit is a Garmin nüvi 660. Evidently Costco had a fantastic deal, because when he offered to buy me a GPS system, I suggested something much less extravagant.

The device is actually quite friendly for Linux users. When plugged into a USB port, the device simply shows up as a (rather large) mass storage device. The "interface" consists of a bunch of folders into which you may put stuff (e.g., MP3s, audio books, images, et cetera). If you wish to upgrade the firmware, you just plop the firmware file into the right directory and reboot the device. It also works as a standard Bluetooth hands-free unit, and has a very, very good speaker phone. So, if you have taken the trouble of making Bluetooth hands-free units work on Linux, then the nüvi 660 will work fine.

Garmin also helpfully placed the manuals on the device as searchable PDF files. It's a good idea; if you have the device, you have the manuals too. I think this is probably the future of technical documentation and bundled software. Why not just integrate a flash drive into the device? The cost of a 128 MB of flash and a USB interface could barely be more than the cost of printing and distributing manuals and CDROMS (never mind the extra cost of technical support for when those items are lost).

The only downside of the nüvi 660 is that there doesn't seem to be a way of pulling real-time GPS data off of it. When you connect by Bluetooth, it will always show up as an audio device. When you connect by USB, it always shows up as a mass storage device. There doesn't seem to be a way of telling it to be a serial GPS. I may be incorrect on this point, but I have not yet found an option that would make this possible. It is already a pretty sophisticated device,though. I don't see why Garmin couldn't add that functionality in a firmware release...

Percy Julian on NOVA

Posted by Russell on June 02, 2007 at 7:43 p.m.
In February, NOVA aired a program about Percy Julian, which you can now watch online. Julian was a chemist who invented synthesis processes for a number of medically important compounds (e.g., cortisone). He also developed processes for economically synthesizing various human hormones from vegetable sources, like Mexican yam and soybeans.

Julian's discoveries were crucial in synthesizing affordable birth control medications and treatments for arthritis. He also blazed a path into academia and the physical sciences for African Americans.

If you're looking for a good story, go watch the NOVA program.

eBook reader

Posted by Russell on June 01, 2007 at 6:57 a.m.
I had a chance to play with Sony's eBook reader (a.k.a. the PRS-500) at Borders Books today. I was surprisingly pleased with it. It is a comfortable size and shape for reading prose, and the device is thin but not flimsy. If I read a lot of fiction for a living, I would buy one of these devices immediately.

The transition when you "flip" the page produces a very strange visual effect. Imagine you are looking at a page of text, and then someone spills a few blobs of ink on the page. The ink spreads out and covers most of the page, and then fades to reveal the next page. It takes about a second. After you press the next-page button, there is a one second delay before the computer wakes up and starts the re-draw process. So, it's about two seconds to flip the page. It's no slower than it takes to flip a page on an ordinary book, so I don't think it's a drawback.

Also, the screen does not look at all like paper. It looks like a light-gray plastic card printed with darkish-gray text with a matte finish. Although it doesn't have the look-and-feel of paper, the readability is just as good. Or, at least its as good as a paper printed with same color scheme. It's very similar to newsprint.

If I were going to use an eBook reader extensively, I would probably need more than one. The size of the screen is good for reading prose, but it is not appropriate for many other kinds of reading. Newspapers, textbooks and scientific papers really need a larger display area. These works are not meant to be digested linearly; the reader is encouraged to wander among the main body of prose, figures, tables, equations, and their respective captions. You need a display area at least as big as US Letter (8.5" x 11") or A4 (210mm × 297mm), and probably bigger. I would really need a 6" x 9" reader for casual reading and a 18" x 27" reader for serious work.

It would also be of great utility to be able to write on these devices. I can live without handwriting recognition, as long as there is a convenient way of filing and organizing my scribbles.

The eBook Reader is the first Sony product that has tempted me since I declared my Sony Moratorium. Nevertheless, at $350, plus overpriced DRM infested books, it's way outside my budget for this sort of thing.

Birthday!

Posted by Russell on May 31, 2007 at 3:02 a.m.

Tweee!!!

A Surge in Global Stupidity

Posted by Russell on May 22, 2007 at 5:01 p.m.
It looks like CO2 emissions between 2000 and 2004 have increased, which probably isn't a surprise, but the reason why emission have increased actually is surprising. New Scientist reports :
The team then examined the changes between 1980 and 2004 in factors such as population, economic growth, energy efficiency and carbon efficiency (the amount used per unit of GDP). From this, they were able to determine why CO2 emissions accelerated after 2000.

They concluded that the rise in CO2 emissions is not due to a growth in global population, but a reduction in global efficiency. "We are not getting more efficient at using CO2 in the way we projected," explains co-author Corinne Le Quéré from the University of East Anglia in the UK.

The predictions used to estimate how much CO2 we will spew are based on the assumption that we will pursue more efficient technology. This is a reasonable assumption to make, even if there were no environmental impacts to consider -- more efficient generating technology is more profitable to operate. Inefficiency is, after all, wasted money. No one thought that people would be so idiotic as to harm the environment and waste money.

Evidently, up until the year 2000, we were doing OK. Then, suddenly, there was a surge in CO2 production and a sag in efficiency. One might characterize it as a surge in stupidity.

Let's see... what happened in 2000 that might have caused a surge in net global stupidity?

On the Importance of Cleanliness

Posted by Russell on May 20, 2007 at 6:15 p.m.
As we all know, dust kills computers. It clogs up the fans and mucks up their bearings. Eventually they begin to emit an annoying grinding or mooing noise. Even if the racket is tolerated, eventually the computer will stop working.

But even a relatively clean computer suffers from dust. You don't need giant dust bunnies clogging your CPU fan to see a significant impact on its cooling effectiveness. The thin, translucent coating of dust that settles onto anything after a few weeks is actually a pretty good insulator. It's like wrapping your heat sync in thermal underwear.

Here is what happens when you clean off that thin little layer of dust:

I have the polling rate for the temperature set at 1/20 Hz, so this is actually a significant length of time. I mention this to demonstrate that the temperature drop wasn't caused by the compressed air.

It's also worth noting that the hotter a semiconductor (or, in most cases, an ordinary conductor) gets, the higher its resistance. The increased overall resistance will cause larger voltage drops within the gate logic. Semiconductors require a minimum voltage to work reliably. So, you have two options; raise the supply voltage, thus dissipating more power, or run the risk of the voltage dropping too low somewhere in the gate logic, thus causing a logic fault. Either way, it's bad.

If the machine adjusts the supply voltage to avoid a logic fault, the part will get hotter, causing its resistance to go up even more, which requires another increase in supply voltage. One hopes that the cycle damps out before it runs away and the part explodes. So, even a relatively small improvement in heat dissipation can lower the temperature significantly due to this compounding effect.

So, boys and girls, remember to keep your computer clean. It will run cooler, last longer, and use less electricity.

Another basket full of Awesomeness

Posted by Russell on May 19, 2007 at 1:40 a.m.
As it happens, I was wondering whether or not I should buy the latest version of Mathematica when I discovered a fantastic free tool tool that does most of the things I want from Mathematica. Maxima and it's predecessors have been around longer than I've been alive, but I had no idea that there were usable GUIs for it. I find it damn near impossible to see what's going on in a mathematical expression unless it's typeset properly.

So, I've always avoided Maxima because it doesn't have an interface, or so I thought.

There is a fantastic little emacs lisp module called Imaxima that renders Maxima output in LaTeX and embeds it into an interactive emacs mode. So far, I like it much more than Mathematica 5's bizarre, ugly and schizophrenic Motief interface. Admittedly, I haven't yet tried Mathematica's new QT interface, but I suspect it will probably be nicer-looking but more complicated. I prefer simple and direct, and Imaxima is just that.

And yes, after doing a bunch of machine-assisted algebra, you can make interactive 3d color plots directly from emacs. Yes, emacs really does do everything.

Rawstudio

Posted by Russell on May 16, 2007 at 6:05 a.m.
I've been puzzling over how to go about manipulating the NEF RAW images my camera produces. Obviously, it is better in principle to shoot in RAW than in JPEG, but the tools for editing RAW files under Linux do not seem to be very far along. For example, The Gimp doesn't natively support them. But that isn't to say there are no tools. Rawstudio provides pretty solid toolbox of basic manipulations. I can finally fix up the colors in some of my favorite shots.

Now, if only I had some good way of doing demosaicing, I'd be all set.

Second-guessing and Micromanagement

Posted by Russell on May 07, 2007 at 11:12 p.m.
Here is a curious thought regarding "controversy" over whether or not Congress should force Mr. Bush to withdraw the troops from Iraq. For months, the Republican mantra has been that Congress (and the general public) shouldn't try to second-guess the commanders in the field. It sounds reasonable, except for one thing. The military reports to a civilian government. The civilian government, of which Congress is a coequal part, is supposed to tell the commanders what to do.

Obviously, if the civilian authorities give the Military bad instructions, that is a bad thing. So, it stands to reason that when Congress (or the president) gives instructions to the Military, the instructions should be of a nature that recognizes, respects and utilizes the planning and logistics capabilities of the Military. The timetable in the supplemental spending bill did just that; it gave no instructions regarding the operational details of the pullout, and instead would have instructed the Military to put into play its own policies and procedures regarding how to conduct the pullout. The language was crafted explicitly to avoid micromanaging the commanders in the field.

I know it's a rather tired refrain, but the accusations regarding "micromanagement" of the Military is rather hypocritical of this administration. Remember how the US Army War College said the invasion was a bad idea? Yeah...

Ubuntu X.org frustrations

Posted by Russell on May 04, 2007 at 11:20 p.m.
To those of you who may be struggling to get your non 4:3 aspect ratio monitor working under the new Ubuntu release (Feisty), here is the magical incantation that will make it happy:
russell@riouj:~$ gtf 1440 900 60

  # 1440x900 @ 60.00 Hz (GTF) hsync: 55.92 kHz; pclk: 106.47 MHz
  Modeline "1440x900_60.00"  106.47  1440 1520 1672 1904  900 901 904 932  -HSync +Vsync
Place the output into the "Monitor" section of /etc/X11/xorg.conf, and restart X. Obviously, choose the resolution and frequency that is suitable for your monitor. The one above is appropriate for an iMac G5.

A Riposte

Posted by Russell on April 30, 2007 at 7:48 a.m.
Oh dear, I seem to have been noticed.

Before I begin my riposte, I need to set something straight. Mr. Dougherty, you have put words in my mouth that I did not and shall not utter. You seem to believe that the conclusions I draw about the wisdom and feasibility of the war in Iraq preclude any appreciation for the oath you, and millions of others, have taken to defend our country. With respect, sir, don't be an ass. It is rhetorically convenient to suppose that those who call you on your errors are incapable of respecting you. I don't mind saying that I respect your commitment to our country. I respect the sacrifices you have have made and risked -- which, since we are having this argument, were thankfully not as terrible as they might have been. I respect the commitment and dedication on your part that must have been required to serve.

But my respect for you, and your brothers and sisters in arms, does not call for genuflection. It does not give you the license to make pronouncements on whether or not I take for granted the rights you swore to protect. I won't belittle the nobility of your service, but I won't tolerate your sanctimonious finger-wagging either.

I called you out as a Republican, not a conservative, because your post is simply package of recycled RNC and Whitehouse talking points:

  • Pessimism about the war hurts the troops
  • Admitting Failure == Surrender
  • Demand an apology for an imaginary insult on behalf of hypothetical people (double points if the uttering of the imaginary insult is required by the target's job description)
  • Pessimism about the war hurts our diplomatic position
  • Opposing The War == Not Supporting The Troops
  • We could still win if only ______ would let us
  • Draw a parallel, any parallel, between the Iraq War and World War II
Listen to any speech by Mr. Bush about the war, and you'll find at least one or two of those. Ditto for practically any stump speech by a Republican candidate in 2004 or 2006. It's all political blather. I'm picking on you because you are clearly smart enough to come up with your own opinions, but instead you are regurgitating the electioneering twaddle of a bunch of political hacks.

Not all politicians are hacks. Even among this disastrous crop Republicans, there are those who have detectable levels of Principle and Decency. You can spot them easily enough; they're the ones who've been slouching around the Capitol looking shamefaced and embarrassed.

But more important to the point at hand, you don't need to be a hack too. You claim to be motivated by conservatism, so perhaps you should meditate on the principles espoused therein. The conservative intellectual framework rests upon the principles of prudence, caution and the admission only of postulates supported by strong empirical evidence. It isn't anything so crude as the "ideology" for which you mistake it. The position you take on the war, and the war itself, is not "conservative" at all. It is either radical or reactionary, depending on how you look at it. The war was not prudent; it was gratuitous. The war was not cautions; it was reckless. The evidence supporting the war was a potpourri of cheap forgeries, bloviation, bureaucratic doublespeak, and wild speculation. As a liberal, I find it bizarre and unsettling to have to extol the virtues of conservationism. I wish the Republican party would send its nutcases home and try to remember some of the wise words of Lincoln, Taft and Eisenhower. Then maybe we could have a debate about ideas instead yelling about who is more patriotic.

Anyway, setting aside your misuse of the word "obsession," I fail to see how your commendably concise definitions of "insurgency" and "counterinsurgency" are somehow different from the phenomena I discussed in my previous post. Except, perhaps, for one minor point: The government of Iraq can hardly be credited for the counterinsurgency operation underway there. It's our people doing the work, taking the risks, and getting killed. The Iraqi government is engaged in counterinsurgency operations in about the same way that Paris Hilton is a plastic surgeon; the operations are carried out on their behalf by someone else who knows what they are doing, and in both cases, the efforts are wasted. Paris Hilton is still ugly, and the Iraqi government is still doomed.

I can only assume that you mention the viciousness and horror of the terrorist actions of the insurgency because you wish to imply that I do not care. Since it offends your sensibilities so, I shall refrain from flexing the more rustic aspects of my vocabulary; they cannot, in any event, capture the profound vulgarity of your suggestion. But as terribly as my heart aches for the lives snuffed out by this ongoing brutality, I know that America's counterinsurgency effort in Iraq is an impossible mission. We cannot stop the bombings, no matter what we might try.

Maybe if we had a million troops to send to Iraq, and a time machine to send them to 2003, maybe then we could stop this slaughter of innocents. But not now, not with an army trained for a different mission and equipped barely even for that. Not when the mission depends on stretching the Army, Marines and even the Reserves to the breaking point, and holding them at the breaking point indefinitely. Not with 15 month tours of duty under mind-wrecking conditions. Not when our injured veterans come home to mildewing hospital beds and are left to rummage in the Goodwill bin for a pair of underpants. Not after letting Saddam Hussein be lynched by a mob of Sadrist hooligans after a wartime show trial, when he should have been executed after an internationally recognized tribunal. Not after Abu Garib. Not after sending 700,000 Iraqis to early deaths. Yes, sometimes counterinsurgency operations can work. But not in Iraq in 2007. It has already gone too far.

As for your final note, had you taken your own recent advice and Googled the quote, you would have found that it was very much in context. Taft was a staunch isolationist, and the remarks of his that I quoted relate specifically to the war, not the New Deal. No, when he made those remarks twelve days after Pearl Harbor, not even Taft, the ardent isolationist, could call the war "won" or "lost." But he and his party did indeed blame Roosevelt and Lend Lease for provoking the attack on Pearl Harbor (a conjecture not without some merit). Taft openly attempted to obstruct the drive to mobilize America for the war against the Axis powers -- as was his right and his duty as per his principles and his office.

You can find the episode in any decent history book or biography of the major personalities involved (particularly Roosevelt and Eisenhower). Most recently, it appeared in an article in Salon about Tom Daschle.

As for Veteran's day, regrettably, my gallery of Veteran's Day photographs is offline at the moment. I will remedy this as soon as possible.

Buying the War

Posted by Russell on April 28, 2007 at 8:25 a.m.
I watched Bill Moyers's "Buying the War" a few days ago, and I finally think I have something to say about it. A lot of people will probably be inclined to skip this report rather than face frustration of seeing, one more time, just how badly we screwed up. It is indeed saddening and frustrating to contemplate the sequence of events that led up to the invasion of Iraq.

However, for some reason, I didn't feel that way at all after watching this report. It's odd, in a way. The report is utterly damning -- damning of the media, of the administration, of Congress, and implicitly damning of the public for allowing itself to be bamboozled. Yet, somehow, I came away feeling relieved.

This is the first time I've seen the whole sequence of events, chapter by chapter, explored in specific detail. After something terrible has happened, it is always worthwhile to go back and give it a really hard look. It's not just to learn from the mistakes; it's also to try to draw a line around the episode. This mental encapsulation is an important coping mechanism. It is what keeps the taint of disaster from seeping into everything. It is what allows us to distinguish between the disaster and unimpacted or unrelated events. It places finite bounds on the scope of the disaster, huge though it may be. This is why the 9/11 Commission Report is important.

Most people who would criticize the Administration, Congress or the Media would construct their indictments on the strength of hindsight. They said one thing, one would argue, but we now know that it was wrong. This is the natural way to proceed. If you want to construct a strong argument, it is best to use the strongest evidence. The strongest evidence is always available after the fact. Ergo, an argument from hindsight is usually the strongest.

For example: The President said Iraq had weapons of mass destruction. We've now searched every inch of Iraq, and there weren't weapons of mass destruction. Therefor, the President was wrong. Yet the President had seen convincing evidence that there were no weapons of mass destruction when he made those statements. We must thus conclude that the President was either lying or demonstrated extremely poor judgment.

Bill Moyers avoids that line of reasoning completely. Instead, he focuses on the people who got things right without the benefit of hindsight, and builds his incitements on the contrasts between their actions and the actions of those who got it wrong. For example, Walcott, Landay and Strobel from Knight Ridder did just what reporters are supposed to do. They thought the Administration's case was a little fishy. So they investigated, and piece by piece, they found that the Administration's case was total malarkey. They reported the details to the public.

Before the tanks crossed the border, every major point in the Administration's case for the war had been publicly disproved, discredited, or refuted. Yet somehow, the public was not aware. How did that happen? This is the question addressed in "Buying the War."

The prevailing news narrative was that Saddam Hussein was a dangerous, evil man, that he had weapons of mass destruction, and that he wasn't going to back down. The investigations that ultimately discredited the prevailing narrative did not appear all at once, or organized into an easily digested rhetorical package. The media outlets regarded these stories as distracting clutter, and kept them off the front pages.

The formation of a prevailing narrative isn't a unique phenomenon. This is how the media operates. Usually, the prevailing narrative is mostly right. This time, though, it was utterly and spectacularly wrong.

Once again, I find that it's easier to face a problem when I understand some of its details. Even as the Media as an industry was galloping down the wrong trail, there were many reporters doing honest, good work. Before I had heard of Walcott, Landay and Strobel, I assumed that there must have been a few reporters who refused to be railroaded. I found it very comforting to see, in detail, that these reporters were not merely hypothetical. I also found it comforting to see how much of the truth they were able to uncover.

Some people will watch "Buying the War" and walk away with anger and frustration. I walked away with relief. It tells me that the flaws in our national media are bad, but at least they are finitely bad. It tells me that good reporting is possible, even in the worst of political climates. If the prevailing narrative had been more permeable to new information, maybe we wouldn't be in this mess. The problem that crippled America's media industry rests in the boardrooms of a few television networks and newspaper publishers. I find that very comforting. It no longer seems like a vague yet crippling general malaise.

A clear statement of a problem usually points directly to its own solution. People have blamed the crummy reporting leading up to the war on the management of the New York Times, CNN and the broadcast networks. Nothing much has changed as a result. This is because no one has had a clear idea of what to blame them for. The managers could always throw up their hands and say, "What could we do? How could we have known?"

Now we know: Stop trying to package the news as if it had a coherent narrative. This is real life, not the movies.

Watch the show. If you can spare a few dollars, maybe think about contributing to public television.

A basket full of Awesome

Posted by Russell on April 28, 2007 at 6:13 a.m.
Sadly, even as more and more businesses are becoming savvy to the idea that open communication empowers employees more than it distracts them, there are still a lot of employers who just love blocking ports and banning websites. It probably isn't even a management decision. It's just something the IT department does to make their own lives easier.

Not that I don't sympathize. Keeping any significant number of PCs free of malware is difficult enough when your user base can't install software. I just don't think the jack-booted thug approach serves the interests of employees or the company very well.

So, if you are unfortunate enough to live or work someplace that blocks SSH, and/or you cannot install an SSH client, there is a solution. If you have a server somewhere, just install AjaxTerm. Then you can log into a cute little AJAX terminal using an ordinary web browser (don't forget to use SSL). The terminal itself is surprisingly snappy. It is even snappier over SSL. It's not quite as interactive as a local xterm, but it's quite usable. It's a bit like using a 2400 baud modem.

It's dead-simple to install, too.

Purify the Internets!

Posted by Russell on April 23, 2007 at 7:48 p.m.
Hu Jintao wants to cleanse the Internet of objectionable material. Evidently, the Internet is full of foul language, pornography, and worst of all, upsetting politics and strange spiritual stuff. On one hand, I feel a great deal of sympathy for the Chinese people, who will see their hard-earned cash wasted on an initiative that will only serve to brutalize them.

China's Internet policy is already responsible for the political incarceration of large numbers of Chinese citizens, most of whom are probably staunch patriots (perhaps with unpopular opinions, though). Expanding state control over the Internet will only accelerate this. To some extent, human nature is irreducibly subversive. It is a necessary part of healthy human psychology to be somewhat resentful of authority. Resentment of authority is a necessary aspect of self-preservation. Increasing state surveillance will of course turn up more subversive thinking. Perfect surveillance would reveal that all of us are subversives, and the remaining few who are not suffer from serious cognitive disabilities. So, if Hu Jintao wants to lock down the Internet, he's going to have to lock up an awful lot of people.

On the other hand, as a patriot of my own country, Hu Jintao's calls to "purify" the Internet bring a smile to my face. If China is successful in its efforts, which is no certain thing, they will destroy their own patch of the Internet. Sure, they will still have a high-tech national computer network, but it won't be the Internet with a capital "I." It will be something else -- something much, much less valuable. No interesting services will survive on this "purified" Internet. The content will be just as interesting and as valuable as Party-controlled television. Meanwhile, Americans can continue building new and interesting things.

America has ceded its dominance in industry after industry to China. Hu Jintao's "purified" Internet is a guarantee that America will keep its dominance of Internet technologies. Unless, of course, our indigenous Internet purifiers succeed.

Talking back to the talking points

Posted by Russell on April 21, 2007 at 6:53 a.m.
I normally avoid reading Republican blogs. This isn't an ideological choice -- there are a few conservative bloggers who I find quite informative. Somehow, thought, this caught my eye:
Republicans blast back in response to comments made by the Senate Majority Leader Harry Reid about the war in Iraq. OK, I get it, Senator Reid doesn't like the war and probably does not like President Bush. But will someone please tell me the benefit of spouting off in public to the news media that the war in Iraq is lost.
Yes, I can tell you exactly what the benefit is. If we have lost the war, and by all objective measures we have indeed lost the war, then it is absolutely imperative to "spout off in public" about this fact. That is the only way anything can be done about it. Harry Reid is one of the leaders of our country, and so it is his responsibility to lead, both on the day-to-day business of running the government and also by shaping the national dialog. It is his solemn, sworn duty as a servant of the public to spout off about it.

I'll set aside the author's conceit that one can really know the mind of Harry Reid, or anyone else, well enough to guess their likes and dislikes. It has nothing to do with whether or not he "likes" the war or "likes" the president. A man in Harry Reid's position has very little time to entertain his own likes and dislikes. When the stakes are that high, personal likes and dislikes are irrelevant. There is only room for cold analytical judgment. People have different priorities and different theories, and so judgment varies. Harry Reid judges the war lost, due in large part to the president's incompetence. Most Americans came to the same conclusion more than a year ago.

You may of course disagree with Mr. Reid. Maybe you think the war is going great. We are each entitled to draw our own conclusions. But what sort of thinking would lead you to question the soundness of Mr. Reid's decision to publicly state his conclusion?

If I was a soldier on the ground in Iraq, I'd be questioning the next time I’m out on patrol just what the ... am I doing out here?
So, basically, you argue that Mr. Reid's remarks might cause our soldiers to question their mission, and so he should apologize. Utter nonsense. If they can handle being shot at, then they're tough enough not to be vexed by a argument a dozen steps up the chain of command. A responsible commander doesn't make strategic decisions based solely on the supposed anxieties of the rank and file.

In any event, from what I am given to understand, our solders have been wondering what the fuck they are doing in Iraq since they got there. I include the word "fuck," rather than an coy little ellipsis meant to stand it its place, because that is exactly how a soldier on the ground in Iraq right now would phrase it.

People around the world (especially in Iraq) who don't completely understand how our government functions could view Reid's remarks as speaking for the U.S. Government and hurt our ability to garner support from the citizens of Iraq. In addition, his comments show me that he has very little understanding of the ability and determination of our men and women serving our country in the Armed Forces.
Rubbish. We have already lost all ability to garner support in Iraq. We lost that about two months into the operation. We lost our ability to garner support everywhere else before we even invaded. The Iraqis want us to leave immediately, and the rest of the world never wanted us to go there in the first place. If anything, Mr. Reid's remarks have boosted our support in Iraq and around the world simply because they are evidence that America is capable of seeing the obvious truth.

Determination and ability have nothing to do with it. A popular insurgency cannot be defeated. France discovered this in Algeria, the Soviet Union discovered this in Afghanistan, and we discovered this in Vietnam. America was born in a popular insurgency against what was then the most powerful military and economic force in the world. We, of all nations, should understand the power of an insurgency.

History has shown that the only effective strategy to defeat a popular insurgency is genocide. This is how successful wars of conquest have worked for all of recorded history. Insurgencies tend to run out of steam once a third of the population has been exterminated. If we want "victory" in Iraq, then that's what we'd have to do. So far, our intervention in Iraq has killed about 700,000 people (about one in ten from direct violence). That's about 3% of the population. We can expect the insurgency to fall apart when we've killed ten times as many people. What Harry Reid means by "lost" is that the only path to victory available to us is too horrible to contemplate.

So what does Mr. Dougherty suggest we do?

A realistic goal, especially if we allow the finest military in the world to take their gloves off and conduct a tactical war that would bring the enemy in Iraq to their knees. Unfortunately, innocent people may get hurt in the process, but we'd complete our mission with honor and avoid many of the ghosts that haunt us now from the Vietnam era..you know...the ones politicians frequently remind us about daily with the media's help.

That's right. He wants America to literally get medieval on the insurgency. So that we can "avoid the ghosts" of Vietnam. So that we can avoid the embarrassment of admitting that we stuck our national dick into a meatgrinder. Maybe he hasn't studied enough history to realize how many people would have to die. Or maybe he has, and doesn't care.

George Bush sent our troops on an impossible mission. As usual, they have served with exemplary professionalism, but that doesn't change the fact that it's an impossible mission. He could have ordered them to invade Atlantis, or build a perpetual motion machine, or exactly express Pi as a ratio of two integers, and it would be no less impossible. Harry Reid is saying that it's time to admit that the situation is fucked, it's time to repudiate the men who caused the mess, and it's time we brought our kids home.

Just recently I listened to one of those audio books titled the Memoirs of Major Dick Winters, you probably remember his story from the mini-series titled Band of Brothers which aired on HBO. When I think back now about the campaigns he and Easy Company fought in during World War II within the European Theater, I shudder to think how they would have responded to such negative comments from a member of the House or Senate (especially the Senate Majority Leader) announcing publicly that we're going to lose the war in Europe. Back then responsible politicians didn’t do things like that...we're Americans for crying out loud! We're supposed to be on the same team aren’t we? Politicians...NUTS!
Shudder away. Starting only days after the attacks on Pearl Harbor, the Republican minority vocally opposed Roosevelt, the war and the continuation of the New Deal. They were told not to question the president in a time of war. They were sternly admonished for undermining the moral of our troops and giving comfort to the enemy. Robert Taft, the minority leader, had this to say:
As a matter of general principle, I believe there can be no doubt that criticism in time of war is essential to the maintenance of any kind of democratic government ... too many people desire to suppress criticism simply because they think that it will give some comfort to the enemy to know that there is such criticism. If that comfort makes the enemy feel better for a few moments, they are welcome to it as far as I am concerned, because the maintenance of the right of criticism in the long run will do the country maintaining it a great deal more good than it will do the enemy, and will prevent mistakes which might otherwise occur.
This brings us full circle. Joe wanted to know what the possible benefit of publicly opposing the war could be. There you have it, Joe, from the mouth of the Republican minority leader, defending his opposition to the war you glorify.

Using Ekiga with an Apple iSight

Posted by Russell on April 21, 2007 at 3:14 a.m.
Now that Apple is integrating little video cameras into most of its products, the venerable Apple iSight has been discontinued. This is very good news if you happen to know a Mac user who likes to buy new things. Chances are pretty good that they have an iSight that they no longer need. Despite being discontinued, the iSight still seems to command its former full retail price on eBay for reasons I do not understand. However you get your hands on one, the iSight can be made to work on a Linux machine without too much difficulty.

The iSight isn't a particularly wonderful video camera, but it is pretty ideal for videoconferencing. So, here is how to get the iSight to work with Gnome's videoconferencing software, Ekiga. I will assume that you know how to find and install software on your computer.

You will need an ieee1394 port, and you will need to load the following kernel modules :
  • ieee1394
  • video1394
  • ohci1394
  • videodev
You will also need to make sure video4linux (V4L2) and the V4L1 compatibility modules is either loaded as a module of compiled into your kernel. The easiest way to get the device working is with the vloopback kernel module, which you will probably have to download and build yourself (I found the Subversion repository to be easiest to use -- the 1.1-rc1 tarball complained of a missing config.h file).

Once you've got the vloopback module loaded, you should be able to get the camera working using Coriander. When you launch Coriander, it will either work, or it will tell you which kernel modules you are missing. If it works, you should see "Apple Computer, Inc." under the "Camera Select" dropdown menu. The Coriander interface is somewhat counterintuitive and a bit heavy on options, but it is very useful. Go to "Services" and select "VIDEO1394" from the "Method" dropdown menu. Then clicking the "Receive" and "Display" buttons (which are actually toggles, despite appearances) should pop open a video preview.

Chances are, the permissions on the necessary devices in /dev will be wrong, so you may have to run Coriander as root. You should make sure the devices are readable and writable by the "video" group (or whatever you or your distribution deems appropriate for the group name), and then add yourself to that group. You will need to the following devices :

crw-rw---- 1 root video 81, 0 Apr 20 21:57 /dev/video0
crw-rw---- 1 root video 81, 1 Apr 20 21:57 /dev/video1
...
crw-rw-r-- 1 root video 171, 16 Apr 20 21:57 /dev/video1394/0
crw-rw-r-- 1 root video 171, 17 Apr 20 21:57 /dev/video1394/1
...
crw-rw---- 1 root video 171, 0 Apr 19 21:38 /dev/raw1394

Evidently, you don't need these:

crw------- 1 root video 10, 204 Apr 20 21:57 /dev/video/em8300
crw------- 1 root video 10, 206 Apr 20 21:57 /dev/video/em8300_ma
crw------- 1 root video 10, 205 Apr 20 21:57 /dev/video/em8300_mv
crw------- 1 root video 10, 207 Apr 20 21:57 /dev/video/em8300_sp

You may want to use your iSight for something other than uploading images to an FTP site (which Coriander will do wonderfully). If you try to use your iSight with Ekiga, you may notice that even with all the right kernel modules loaded, it's still impossible to configure the iSight via the Ekiga configuration druid. If this is the case, you need to install some packages :

  • libpt-1.10.0 - Portable Windows Library
  • libpt-plugins-alsa - Portable Windows Library Audio Plugin for the ALSA Interface
  • libpt-plugins-avc - PWLib Video Plugin for IEEE1394 (FireWire) AVC devices
  • libpt-plugins-dc - PWLib Video Plugin for IEEE1394 (Firewire) DC Devices
  • libpt-plugins-oss - Portable Windows Library Audio Plugins for the OSS Interface
  • libpt-plugins-v4l - Portable Windows Library Video Plugin for Video4Linux
  • libpt-plugins-v4l2 - Portable Windows Library Video Plugin for Video4Linux v2
Quit Ekiga and try the druid again. You should be able to select "1394DC" for the Video plugin, and "/dev/video1394/0" for the Input device. Clicking the little video icon should start the video preview.

Note: If you close the little shutter on the iSight while Ekiga is running, it will crash. Evidently the shutter actually turns off the device.

Copyright Pirates

Posted by Russell on April 17, 2007 at 3:31 a.m.
So, the Copyright Royalty Board ruled in favor of the recording industry's extortion of internet radio. As an big fan of KCRW, this makes me especially angry. This ruling will pretty much put KCRW out of business; most of their listeners are online.

Naturally, they are scrambling to get more people to subscribe to support the service. If the Court of Appeals doesn't overturn the ruling, I will not subscribe. Nor will I listen. I would rather see KCRW disappear than see my contribution to public radio pissed away on SoundExchange royalty extortion.

Intellectual property law in the United States keeps drifting farther afield from its basis in constitutional law. All intellectual property law in the United States is predicated on this special power of Congress:

The Congress shall have power To lay and collect Taxes, Duties, Imposts and Excises, to pay the Debts and provide for the common Defence and general Welfare of the United States; but all Duties, Imposts and Excises shall be uniform throughout the United States;

...

To promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries;

This decision accomplishes exactly the opposite of "Progress of Science and the useful Arts." Radio broadcasters are not required to pay these extra fees, and internet broadcasting is the logical technological advancement over radio. But then again, a great deal of America's intellectual property law already does more to stifle Science and the useful Arts than encourage it. This is just the latest example.

KCRW and other internet broadcasters can take another direction, though. They could put a blackout on artists represented by SoundExchange. If they do this, I will gladly support KCRW.

Go sign the petition.

Vort.org... now with more math!

Posted by Russell on April 13, 2007 at 5:03 a.m.
Back when Tim Berners-Lee and Robert Cailliau brought forth the World Wide Web, the idea was to create an easier way for researchers to discuss and share their work. For reasons I've never really understood, through many revisions, the specification for web layout has never included a good way of writing mathematics. Now there is this MathML thing that we are supposed to use. It is only now starting to seep into the default configurations of most browsers. Sadly, it ignores the fact that there is already a perfectly wonderful and truly elegant markup language for typesetting mathematics.

So, until MathML takes over the world, or is replaced by something that people might actually want to use, there is a fantastic little program called mimeTeX. Once it is happily nestled in your cgi-bin directory (remember CGI?), mimeTeX will burble forth all the equations you could ever want. You just pass it a string of LaTeX math mode in as a query, and out pops beautiful equations:

It's not the solution that would make the most sense -- a LaTeX engine on the client-side -- but it's the next best thing. So go ahead and blog about math, and stop writing stupid things like f(x-a)/sigma_thingy.

Oh, and if you are too lazy to install it yourself, I warn you now not to use mine. I will use url_rewrite to introduce embarrassing mistakes into your posts.

The Debauchees

Posted by Russell on April 10, 2007 at 2:53 p.m.
I was recently reminded of a customer satisfaction survey I wrote about a year ago. I post it here for the general amusement of all.
Why do you think Radisson Hotel Cambridge should be assigned a lower star rating? (Check all that apply)
  • [ ] Supplier Brand - Hotel Brand doesn't fit customer expectations
  • [ ] Condition of Rooms - Room condition was below standards for that star rating.
  • [ ] Condition of Property - Excluding rooms, the lobby, pool and/or public was below standards for that star rating.
  • [ ] Amenity Issues - Amenity offering was lacking / missing from promised.
  • [ ] Service Quality - Staff service levels were below expectations
  • [*] Other - My reason doesn't fit any of these descriptions

Required: Please tell us more about this issue.

On our last night, the room adjoining ours was occupied by a woman and two men who spent the evening copulating with what I can only describe as "extreme vigor."

Neither I nor my traveling companion harbor prudish views regarding this sort of activity. Indeed, we regarded it with no small amount of amusement. I would have been in favor of increasing the rating for this hotel had it not been for the profoundly disappointing post-coital conversation of Radisson's nocturnal debauchees.

I shall never fathom how their conversation ranged to the relative performance of fantasy football leagues with not more than ten minutes elapsed since a wall-slapping climax. We were appalled that a tryst so enterprising and lively would be concluded in so banal a conversation. Their grand overture of delightful wickedness was cut short by the pathetic, noisome honk and hucksterism of sports entertainment.

The experience shook our faith in humanity's capacity for truly reckless transports of lust. Can three strangers not join together for the gorging of their carnal desires without the intrusion of base commercialism into their merriment? The world seems a duller, shabbier place.

Pelosi in Damascus

Posted by Russell on April 06, 2007 at 3:26 p.m.
Like most people who don't like totalitarianism, I'm not a big fan of the Syrian government. From what I understand, they are not nice people. However, their supposed odiousness is not a good reason to refuse to talk to them. On the contrary. Otto von Bismark described politics as "the art of the possible." Diplomacy is just politics across borders. To refuse to engage in diplomacy is to curtail what is possible. The administration's policy of minimal contact with "bad" governments is guaranteed to accomplish minimal results.

On an emotional level, I can sympathize with Bush's policy toward Syria. I'd like to personally avoid talking to the Syrian government, if at all possible. But someone has to talk to them. The Syrians may have important influence in a situation in which America is deeply involved. I, and 300 million other Americans, pay Mr. Bush to talk to Syria so we don't have to.

So, if Speaker Pelosi wants to roll up her sleeves and do some of the necessary diplomatic work the administration refuses to do, I'm perfectly happy to let her. Of course, as a member of Congress, she can't hold binding negotiations with the Syrians, but she can have a dialog. That's better than nothing.

Naturally, the administration is positively wigging out. The most serious accusation is that Pelosi is "undermining" the administration's foreign policy. In a general political sense, I suppose that might be bad. It would certainly strengthen the administration's foreign policy position if the Speaker of the House supported it. If the policy were any good, support from Congress would make it better. But in this case, the administration's foreign policy has been an unmitigated failure. I hope, for the sake of the nation and the world, that Pelosi is undermining it.

In any event, there is nothing that compels a citizen, or a member of Congress, to uphold a particular foreign policy. That's the difference between policy and law. George Bush cannot order me to help him with his foreign policy, nor can he so order Speaker Pelosi. Since neither I nor Speaker Pelosi are part of the executive chain of command, we can act within the limits of the law to support or undermine executive policy as it pleases us. Period.

However, I don't think Pelosi's talks with the Syrians have done anything to undermine Bush's foreign policy. Unless, of course, George Bush's foreign policy is simply to aggrandize himself. If that is the policy, then maybe Pelosi has undermined it a bit.

SCOTUS hearts Earth

Posted by Russell on April 02, 2007 at 3:04 p.m.
In a 5-to-4 decision, the Supreme Court has found that the EPA can (and possibly must) regulate the emissions of greenhouse gases. The case was brought by Massachusetts, California, Connecticut, Illinois, Maine, New Jersey, New Mexico, New York, Oregon, Rhode Island, Vermont, Washington, Baltimore, the District of Columbia, New York City, and a cadre of environmental groups.

This will pave the way for a whole host of innovative policy options. For example, scaling vehicle registration fees with fuel efficiency, mandatory fuel economy standards, various kinds of carbon taxes (and credits), and all sorts of good stuff. The decision removes one of the biggest obstacles to policy implementation.

The media is probably going to focus on the potential nation-wide impacts, but I don't think Congress or the White House will come up with anything interesting. Even if 2008 is a banner year for Democrats, the federal government probably isn't going to enact any interesting or effective environmental policy. Realistically, a positive role in in environmental policy for the federal government will be in funding capital projects and research, and as an experienced manager of data.

The states are a different story. The decision will (I think) allow state-EPAs to move forward with regional policies. For example, California can finally enact the fuel economy standards for which it has fought for so long, or Massachusetts can get more aggressive about wind power. Some of the states will do nothing, and some will try things that turn out to be dumb. However, some of them will have the will and the know-how to come enact policy with real promise. The ideas that work will be copied, eventually percolating upward to federal policy after a generation or so.

Hooray for Federalism!

Python numerical stuff

Posted by Russell on March 30, 2007 at 6:16 p.m.
A few years ago Eric Hagemann wrote some nice articles for the ONLamp Python Devcenter about numerical programming in Python. Is there any way to encourage him to write more, with more up-to-date modules?

PDQ Julia Set

Posted by Russell on March 29, 2007 at 9:01 p.m.
I was up late last night while waiting for the laundry to finish drying, and was annoyed at myself for wasting time fooling around on the internet. So, I decided to try to remember how to plot the Julia set. I vaguely remember doing this in high school, so I turned off my wireless card (so I couldn't cheat) and timed myself to see how long it would take me to figure it out.

After 11 minutes I got this. Not bad. It's not the most efficient way of plotting it, and I didn't bother to use modular arithmetic to handle big numbers (that's why I only go to six iterations). Here is my (very stupid) Julia set calculator.

#!/usr/bin/env python
# vim: set ts=4 sw=4 et:
from numpy import *
from scipy import *
from pylab import *

def julia( l, I, M ) :
    a = zeros( (I,I), Float64 )
    for i in range(I) :
        for j in range(I) :
            N = complex(-2.0+i/(0.25*I),-2.0+j/(0.25*I))
            for m in range(M) :
                try :
                    N = (N)**2+l
                except OverflowError :
                    N = 10000000000.0
                    break
            a[i,j] = abs(N)
    return a

l = complex( 0.4, 0.3 )
a = julia( l, 200, 6)
contourf( log(a), 32 )
colorbar()
#contour( a, [1], colors='black' )
show()

The Train Nazi

Posted by Russell on March 24, 2007 at 8:48 p.m.
[From Yesterday]

Mimi and I are on the Acela Express to New York, and we made the mistake of sitting in the Quiet Car. The quiet car features a conductor that yells at you every time you whisper to the person next to you. If you take out your cell phone, even to turn it off, he yells that there are no cell phones on the Quiet Car. Then when you put it away, he yells at you again. If you are listening to headphones, he yells at you about the tiny, nearly inaudible twitters that escape into the aisle. And I do mean inaudible -- I had no idea the person sitting three feet behind me was listening to music until the conductor brought this to the attention of everyone on the car. He even glared at us and hovered over our seats because he caught us passing notes to each other.

The net effect is that this easily is the loudest car on the train. The sign says, "Please refrain from loud talking or using cell phones in this car." Evidently, the conductor interprets this as "No communicating whatsoever."

If he simply gestured, or shushed people, that would be fine. If he asked politely, that would be fine. This is insulting.

We would have moved to another car, but this is where the last seats were. Evidently, no one wants to sit in the Quit Car, and no wonder.

Free at last!

Posted by Russell on March 21, 2007 at 8:25 p.m.
I just turned in my final. The exam period isn't over yet, so I'll wait until afterward to talk about it more.

Meanwhile, I'm off to Boston and New York for a much needed break.

Quantum Final: Update

Posted by Russell on March 19, 2007 at 9:43 p.m.
Did I mention that scattering theory sucks? Allow me to reiterate. Scattering theory sucks.

Quantum Final

Posted by Russell on March 18, 2007 at 12:37 a.m.
Halfway done with the quantum final.

Scattering theory sucks.

Lecture Summary 03/7/2007

Posted by Russell on March 07, 2007 at 2:08 p.m.
Today we discussed transitions using time independent perturbation theory. Some strange things happened with relativity that I didn't catch. OK -- I didn't catch it because I was working on a homework assignment during lecture.

The end result was the formula for the decay transition of an individual system, which coincidentally is the same as the formula for fractional decay in a bulk material from statistical mechanics. The two decay rules are distinct, as they are based on different physics and describe different systems.

The lonely ballot

Posted by Russell on March 07, 2007 at 5:01 a.m.
Evidently I was the only one in my district who noticed the Official Sample Ballot that showed up in my mailbox a few weeks ago. When I walked into the the building (a Goodwill donation center near my apartment), the poll workers regarded me with astonishment and bewilderment. "Can I... Can I help you?" one of them asked.

It was well past noon, and they'd been there since 8:00. Besides the five of them, I was the first voter to arrive. They'd been drinking soda, telling stories and playing cards all day. I inked my ballot, dropped it into the scanner thingy. I could actually hear it go thunk into the empty plastic bottom of the ballot box.

I live in a very crowded West Los Angeles district; by population alone, I'd guess that there are a few thousand people assigned to my polling place.

On Sunday, I handed out fliers at an Albertsons grocery store for Bennett Kayser, who is running for the school board (Bennett and Peggy Kayser are old family friends). Almost everyone I spoke with -- about a thousand people -- was surprised to learn that there was an election coming up. Not a single person remembered receiving a sample ballot. Evidently, my observations weren't anecdotal:

Despite the high stakes and high spending, Tuesday's election was marked by low turnout. Poll workers sat waiting futilely in school auditoriums, offices and churches across the sprawling, 700-square mile district that serves Los Angeles and more than two dozen other cities.

"This is the lowest turnout I've ever seen," said Leslie Spikes, who has worked at a polling station in an education center on West 48th Street for the last three years. "It's kind of sad when you think it's about the kids."

Depressing. California has too many damn elections.

The Economy != The Stock Market

Posted by Russell on February 27, 2007 at 8:36 p.m.
The Dow had its worst day since the September 11th attacks today, falling 416 points following a major correction in the China's stock markets. This is a good time to remember something that reporters and politicians often forget: The economy isn't the stock market.

For several years, the stock market has been booming while most Americans are facing increasingly worse financial situations. In 2006, the personal savings rate went negative for the second year in a row -- something that hasn't happened since the Great Depression. Every time Bush talks about the economy recently, he tells us how the economy is "strong." Piffle. The economy might be growing, but it is anything but strong. "Growing but extremely fragile" is a more accurate characterization.

Nevertheless, when the stock market has a shock, the axiom still holds. The stock market isn't the economy. Bad news on Wall Street might actually be a good thing for America right now. It's about time that the rich and powerful catch a gust of the ill winds that have been ravishing America's poor and middle class. Maybe they will put down their cognac long enough to help us do something about it.

Lecture Summary 02/26/2007

Posted by Russell on February 26, 2007 at 3:01 p.m.
Today's was scattering galore. When I got to class, Abers was in the middle of a long calculation, and I never found out what it was he was calculating. There were Green's functions involved, so it must have had something to do with the Born approximation. Poisson and Fresnel were mentioned as well, and the appearance of the latter name sheds some light (har har) on the nature impermeable mathematics.

Next, Abers calculated the classical cross section for a sphere (it's just the cross sectional area of the sphere) and the cross section to propagating plane wave (four times as big). In the region of small-angle deflections, the wave equation undergoes constructive interference. Both calculations is pretty fundamental, so I'll revisit it once I finish the homework for the variational principle.

Update: Here is once case where I am deeply grateful for Abers' book. His lectures match the book exactly, so if I miss something in class, I know I can always find it later. My hunch was correct; he working through the Born series for spherically symmetric potentials.

More like this, please

Posted by Russell on February 21, 2007 at 5:27 p.m.
Over the years, I've grown to loathe air travel. The major carriers are suffering from a deep institutional decay, and airports have turned into a nightmare landscape of law enforcement gone mad. Airports are little pockets of brutal, bureaucratic totalitarianism in an otherwise mostly free country. If you want to know what fascism would look like in modern America, just visit an airport, and imagine a whole city run that way. Fascism in Germany was characterized by the German mania for efficient organization. America doesn't do efficient organization. Fascism in America would be huge, blundering and incompetent. The catchphrase of German fascism was, "Papers, please." In America, it would be, "We can't find your papers." It would be like an airport.

It would be bad enough if it weren't for the surly attitude and lousy service from the major airlines. The IRS is better at customer service than the major carriers. They really are. The first time I had to file a tax return, I didn't even know where to start. I called the IRS. They were polite, answered all my questions, and explained how to fix things if I made a mistake. The told me how to file for an extension, if I needed to. They gave me a list of local certified tax accountants if I wanted more technical advice. They were even cheerful about it. Good luck finding that kind of treatment from an airline official on a busy day.

That said, I've always liked JetBlue. They are one of the few bright spots in an otherwise rotten industry. If there was some way that I could board their flights without having to run the gauntlet of idiotic airport hassle/security, I might actually enjoy flying.

Last weekend was a very bad weekend for JetBlue. Leaving thousands of passengers stranded and angry, it seemed that their effort to be the Good Airline might have finally broken. Fortunately, that seems not to be the case.

Dear JetBlue Customers,

We are sorry and embarrassed. But most of all, we are deeply sorry.

Last week was the worst operational week in JetBlue's seven year history. Following the severe winter ice storm in the Northeast, we subjected our customers to unacceptable delays, flight cancellations, lost baggage, and other major inconveniences. The storm disrupted the movement of aircraft, and, more importantly, disrupted the movement of JetBlue's pilot and inflight crewmembers who were depending on those planes to get them to the airports where they were scheduled to serve you. With the busy President's Day weekend upon us, rebooking opportunities were scarce and hold times at 1-800-JETBLUE were unacceptably long or not even available, further hindering our recovery efforts.

Words cannot express how truly sorry we are for the anxiety, frustration and inconvenience that we caused. This is especially saddening because JetBlue was founded on the promise of bringing humanity back to air travel and making the experience of flying happier and easier for everyone who chooses to fly with us. We know we failed to deliver on this promise last week.

We are committed to you, our valued customers, and are taking immediate corrective steps to regain your confidence in us. We have begun putting a comprehensive plan in place to provide better and more timely information to you, more tools and resources for our crewmembers and improved procedures for handling operational difficulties in the future. We are confident, as a result of these actions, that JetBlue will emerge as a more reliable and even more customer responsive airline than ever before.

Most importantly, we have published the JetBlue Airways Customer Bill of Rights—our official commitment to you of how we will handle operational interruptions going forward—including details of compensation. I have a video message to share with you about this industry leading action.

You deserved better—a lot better—from us last week. Nothing is more important than regaining your trust and all of us here hope you will give us the opportunity to welcome you onboard again soon and provide you the positive JetBlue Experience you have come to expect from us.

Sincerely,

David Neeleman
Founder and CEO
JetBlue Airways

Sincere apologies are rare in our culture. The best you'll hear in most cases is something like, "We are sorry that this unfortunate thing has happened." So, when the CEO of a major airline sends an email to his company's customers that says, "Words cannot express how truly sorry we are for the anxiety, frustration and inconvenience that we caused." He doesn't even blame the storm, or the facilities, or bad luck. This is called "taking responsibility." It's something that grown-ups are supposed to do, but that CEOs and presidents and small children usually do not.

The Passenger's Bill of Rights is a good idea. It's what airlines should have been doing all along.

Taking responsibility when things go wrong is probably the most important function of a leader. It's something that our current national leadership is notoriously bad at. It should come as little surprise, then, that JetBlue is the only US carrier that is a significant contributor to the Democratic party.

Lecture Summary 02/19/2007

Posted by Russell on February 19, 2007 at 7:25 p.m.
There is no class today on account of President's day. Instead, here is the summary for Wednesday's lecture, which I neglected to post.

We began examining the geometry of the scattering problem. The scattering geometry is this: A target sits at the origin of a spherical coordinate system. A beam of particles is directed at the target. The target is treated as a macroscopic object, so the beam is expressed in terms of a "probability current." This is simply a way of treating a continuous stream of traveling wave functions. Of course, each wave function must be normalized, but because the beam is switched on for an arbitrary length of time (forever) the beam itself is not. Thus, the probability current formalism describes the flux of probability through the surface. Typically, one would choose the surface to be the beam-facing surface of the target.

Some sort of interaction occurs among the particles in the target and the particles in the beam; usually, the particles in the beam are scattered off of a potential in the target. The Rutherford scattering experiment is an example of a beam scattered by a potential. Alternatively, interaction with the beam could change the state of the target; a photon beam could excite the valence electrons in the target, which would eventually return to the unexcited state and re-emit the photons, or beam of positrons could annihilate with electrons in the target, or a beam of high-energy neutrons could smash the target nuclei into assorted atomic debris. If the beam is scattered by the target without changing the state of the target, this is called elastic scattering.

The scattering problem is useful because because beam-target interactions will divert the beam into a characteristic angular distribution of beam particles. The scattering problem can be used to study the properties of the target, the beam, the interaction, or any combination thereof.

Nonrelativistic elastic scattering

To introduce the technique, we consider a beam of nonrelativistic, spinless particles scattered elastically by a fixed potential. Because the number of collisions in a given time will vary with the beam intensity, it is convenient to eliminate the time interval from the equations by expressing the problem in terms of a cross section. The term is an analogy to the classical collision problem; one may imagine the target as a cloud of spheres with a given radius. The classical cross section of such a system would be the sum of the two-dimensional area presented by each sphere to the beam per unit volume of the target. One can think of it roughly as the "effective area" per unit area of the target, or as the "opacity" of the target.

For Coulomb scattering, the beam and the target will not actually contact one another (otherwise we would have to take other forces into account, and it wouldn't be Coulomb scattering any more). The cross section is then the area within which a beam particle will "significantly" interact with a target particle. Rather than specifying some arbitrary definition of "significantly," it is better to define the problem in terms of a differential cross section which scatters the the beam into a differential solid angle. This is better illustrated by a picture, so I'll stop blathering about the geometry.

As I mentioned above, the beam is not normalizable. Generally, one treats it as a plane wave. The scattering problem amounts to calculating over what solid angle the probability current passing through a given differential cross section will be scattered by a potential.

Hit by a car

Posted by Russell on February 14, 2007 at 2:44 a.m.
While I was walking home today, a lady hit me with her car. I was not hurt. Here is what happened.

I was about a quarter of the way across a quiet residential street. A woman driving a brown sedan came down the street I was crossing and stopped at the stop sign. She was a car-length past the line for the stop sign, but not yet into the intersection. She looked up and down the street she was about to cross. I was about ten feet away from the driver side window when she came to a stop. She paused a good long time while looking, so it appeared she was yielding to me. I continued across the street.

I was, by this point, in front of her car. While looking around, she must have somehow failed to notice the large man wearing the bright orange reflectorized jacket. She stepped on the gas, and I fell on her hood to avoid having my knees snapped.

She did not touch the breaks. She simply threw her hands up and let the car roll slowly into the intersection. This is probably the right thing to do if you hit someone at low speed. If you slam on the brakes, you'll toss them off the hood and in front of your car.

I got up on my elbow and looked at her to see what her reaction was. She looked like she was scared shitless. She was about 50 or 60 years old, with short hair in little curls. She had reading glasses on a string around her neck. I did not feel like lecturing someone's grandmother about sharing the road, so I got off her hood and walked away. After sitting in the intersection for twenty or thirty seconds, she drove away.

It occurs to me that people in Los Angeles simply do not look for pedestrians. It is so fantastically unlikely that you will ever encounter anyone proceeding on foot that people forget to take the possibility into account. One is as likely to encounter a unicorn as a pedestrian when motoring in quiet residential neighborhoods. The lady was definitely being cautious. She paused at the stop light for a good long time, and carefully looked each way several times. However, she was just looking for other cars. It must have completely slipped her mind that she ought to look for things other than cars.

Of course, if she had stopped behind the line, she probably would have seen me. That is why they put the line where it is. However, from behind the line, she could not have safely looked down the intersecting street. In such circumstances, you are supposed to stop twice: Once to look for pedestrians (and obey the stop sign), and once to check for cars. Sometimes you can do both at once, but not always.

Modern roads really are a curious invention. Contrary to most people's assumptions, our roads do not exist to allow people to move quickly. It would be simpler (and probably cheaper) to design vehicles that can drive fast without the expense and complexity of a road. The US Army has lots and lots of such vehicles. The problem is that such vehicles are extremely dangerous, which is why we only use them for weapons.

The reason why they are dangerous is that they must be used under complex conditions. The desert basins of Southern California are ideal territory for tanks. However, very few people can safely operate a tank under any circumstances. Safely operating a tank among pedestrians, pets, houses, gardens, mailboxes, fireplugs and wildlife is probably an impossible task.

So, we build roads. Modern roads exist to minimize complexity. This allows drivers to operate on a smaller set of assumptions. This is probably the only reason that most normal people are able to drive at all. I consider myself to be a pretty safe driver, but I know that I don't have the skill, attentiveness and reaction time needed to safely operate a tank in a populated area. If I had to move a tank across Los Angeles, I would would disassemble it and carry each piece in a pickup truck.

No matter how carefully we design our roads, they are a fiction. The real world is too complicated for people to safely drive a vehicle at 25 miles an hour, so we have invented a simpler world where it is safe. Los Angeles is exceedingly good at this. Our roads are logical, the signs are large and easy to read, the lanes are carefully marked, and the stop signs and crosswalks are thoughtfully placed. Unfortunately, the real world always has a way of impinging on our carefully constructed fiction. Unfortunately, the bits of the real world that include cats, dogs and small children do not stand much of a chance against 3000 pound steel projectiles. It is especially alarming when you realize that these projectiles are controlled by people who have just barely enough skill to safely navigate in an imaginary cartoon universe where cats, dogs and small children do not exist.

Evidently, pedestrians in crosswalks are fading out of the fictional world in which ordinary people must live in order to operate a motor vehicle. This is a very scary thought, and it doesn't say anything good at all about Our Fair City.

Lecture Summary 02/12/2007

Posted by Russell on February 12, 2007 at 2:29 p.m.
Today, we applied the Born-Oppenheimer approximation to calculate the nuclear separation distance of the singly ionized hydrogen (H2+) molecule. The trial wave function we used was the linear combination of the two atomic ground state orbitals with a normalization that takes into account the overlap between them.

Once the separation distance had been found (approximately), we calculated the energy spectrum of rotation for the hydrogen molecule. To calculate the vibrational energy spectrum, we expanded the Coulomb potential of the atom to second order. This potential is simply the harmonic oscillator problem. With the correct dimensions, the harmonic oscillator yields a good small-amplitude approximation of the vibrational energy spectrum.

It was noted that for various diatomic molecules, the rotational energy spectrum will also depend on the nuclear spin. Atoms with nuclear spin 1/2 will behave as fermions, and atoms with nuclear spin 0 will behave as bosons. Depending on the nuclear spin, symmetry may forbid certain energy levels. This is a critically important feature of matter that determines the statistical behavior of bulk quantities of the material.

In other news, we will evidently be skipping the WKB approximation so that we can spend more time on scattering.

Defending Marriage

Posted by Russell on February 09, 2007 at 4:01 a.m.
Here is my proposal for a Defense of Marriage act that would, you know, actually defend marriage:
"In the eyes of the government and courts of California, marriage shall be hereby defined as none of its goddamned business."
If gay people are ever allowed to get married in California, it won't be by convincing straight people to care. That isn't to say that straight people don't care; 2,909,370 people voted against Proposition 22. Gay people will win the right to marry when straight people start getting uncomfortable about having the government rummaging around in their married life. Then gay people and straight people can rally behind the same slogan: It's none of your goddamned business. A proudly American sentiment.

Democrats reflexively package their arguments in the terms of wonderful programs and insightful social policy. This isn't going to work for these kinds of issues. Most straight people still feel uncomfortable about actively supporting a policy that will lead to men kissing other men on TV. But most straight people probably would support a policy that would grant